Login to display prices
Login to display prices
INO80B-INO80 complex subunit B Gene View larger

INO80B-INO80 complex subunit B Gene

PTXBC050666

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of INO80B-INO80 complex subunit B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about INO80B-INO80 complex subunit B Gene

Proteogenix catalog: PTXBC050666
Ncbi symbol: INO80B
Product name: INO80B-INO80 complex subunit B Gene
Size: 2ug
Accessions: BC050666
Gene id: 83444
Gene description: INO80 complex subunit B
Synonyms: HMGA1L4; HMGIYL4; IES2; PAP-1BP; PAPA-1; PAPA1; ZNHIT4; hIes2; INO80 complex subunit B; IES2 homolog; PAP (Pim-1 associated protein) associated protein 1; PAP-1 binding protein; PAP-1-associated protein 1; high mobility group AT-hook 1-like 4; zinc finger HIT domain-containing protein 4; zinc finger, HIT type 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggcccctgagccgggagaagccctggagttgagcctggcgggtgcccatggccatggagtgcacaagaaaaaacacaagaagcacaagaagaaacacaagaagaaacaccatcaggaagaagacgccgggcccacgcagccgtcccctgccaagcctcagctcaaactcaaaatcaagcttgggggacaagtcctggggaccaagagtgttcctaccttcactgtgatcccagaggggcctcgctcaccctctccccttatggttgtggataatgaagaggaacctatggaaggagtcccccttgagcagtaccgtgcctggctggatgaagacagtaatctctctccctctccacttcgggacctatcaggagggttagggggtcaggaggaagaggaggaacagaggtggctggatgccctggagaagggggagctggatgacaatggagacctcaagaaggagatcaatgagcggctgcttactgctcgacagcgagctctgctccagaaggcgcggagtcaaccttcccctatgctgccgctgcctgtagctgagggctgcccacctcccgccctcacagaggagatgctgctgaagcgcgaggagcgggcgcggaagcggcggctccaggcggcgcggcgggcagaagagcacaagaaccagactatcgagcgcctcaccaagactgcggcgaccagtgggcggggaggccgggggggcgcacggggcgagcggcggggagggcgggctgcggctccggcccccatggtgcgctactgcagcggagcacagggttccaccctttccttcccacctggcgtccccgcccccacggcagtgtctcagcggccatccccctcaggcccgccgccgcgctgctctgtccccggctgtccccatccgcgccgctacgcttgctcccgcacaggccaggcactctgtagtcttcagtgctaccgcatcaacctgcagatgcggctgggggggcccgagggtcctggatccccccttttggctacgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: