Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SPATA3-spermatogenesis associated 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPATA3-spermatogenesis associated 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047704 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPATA3 |
| Origin species: | Human |
| Product name: | SPATA3-spermatogenesis associated 3 Gene |
| Size: | 2ug |
| Accessions: | BC047704 |
| Gene id: | 130560 |
| Gene description: | spermatogenesis associated 3 |
| Synonyms: | 1700011N12Rik; 1700029H01Rik; 4930424D10Rik; Mtsarg1; Tsarg1; spermatogenesis-associated protein 3; testis and spermatogenesis cell apoptosis related gene 1; testis and spermatogenesis cell apoptosis related protein 1; testis and spermatogenesis cell-related protein 1; testis spermatocyte apoptosis-related protein 1; spermatogenesis associated 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagaaggtcaagaagaaaaggtcagaggccagacgccaccgagactccacctcccagcatgctagctccaattccacctctcagcagcctagtcctgaatccacaccacagcagcctagccctgaatccacaccacagcattccagccttgaaaccacctcccggcagccagcattccaagcccttccagcacccgaaatccgccgctcctcttgctgccttttatctccagatgctaacgtgaaggcagcccctcaatccaggaaagcagggcctctgactcgcgccggcccgcattcctgctcctgtgccacttgcccctgcagctccgcttgctggcgtcgtctggggctatgccatagccgcatcttcgatgtccttctgcctcgggactggcagatggcgccagggagaggactccccaacctgctcaccttctacagaaaatcttcaagaaaaccctccagtcatcgtaacgcgtgtcctccaagccctcggaactgtggctgtggctctgggggctctaggagctgcctactacatcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TBC1 domain family, member 7 - muscleblind-like (Drosophila) - FCH and double SH3 domains 1 - transmembrane protein 120A |