SPATA3-spermatogenesis associated 3 Gene View larger

SPATA3-spermatogenesis associated 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPATA3-spermatogenesis associated 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SPATA3-spermatogenesis associated 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC047704
Product type: DNA & cDNA
Ncbi symbol: SPATA3
Origin species: Human
Product name: SPATA3-spermatogenesis associated 3 Gene
Size: 2ug
Accessions: BC047704
Gene id: 130560
Gene description: spermatogenesis associated 3
Synonyms: 1700011N12Rik; 1700029H01Rik; 4930424D10Rik; Mtsarg1; Tsarg1; spermatogenesis-associated protein 3; testis and spermatogenesis cell apoptosis related gene 1; testis and spermatogenesis cell apoptosis related protein 1; testis and spermatogenesis cell-related protein 1; testis spermatocyte apoptosis-related protein 1; spermatogenesis associated 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagaaggtcaagaagaaaaggtcagaggccagacgccaccgagactccacctcccagcatgctagctccaattccacctctcagcagcctagtcctgaatccacaccacagcagcctagccctgaatccacaccacagcattccagccttgaaaccacctcccggcagccagcattccaagcccttccagcacccgaaatccgccgctcctcttgctgccttttatctccagatgctaacgtgaaggcagcccctcaatccaggaaagcagggcctctgactcgcgccggcccgcattcctgctcctgtgccacttgcccctgcagctccgcttgctggcgtcgtctggggctatgccatagccgcatcttcgatgtccttctgcctcgggactggcagatggcgccagggagaggactccccaacctgctcaccttctacagaaaatcttcaagaaaaccctccagtcatcgtaacgcgtgtcctccaagccctcggaactgtggctgtggctctgggggctctaggagctgcctactacatcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TBC1 domain family, member 7
- muscleblind-like (Drosophila)
- FCH and double SH3 domains 1
- transmembrane protein 120A

Buy SPATA3-spermatogenesis associated 3 Gene now

Add to cart