Login to display prices
Login to display prices
KLK3-kallikrein-related peptidase 3 Gene View larger

KLK3-kallikrein-related peptidase 3 Gene

PTXBC050595

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KLK3-kallikrein-related peptidase 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KLK3-kallikrein-related peptidase 3 Gene

Proteogenix catalog: PTXBC050595
Ncbi symbol: KLK3
Product name: KLK3-kallikrein-related peptidase 3 Gene
Size: 2ug
Accessions: BC050595
Gene id: 354
Gene description: kallikrein-related peptidase 3
Synonyms: APS; KLK2A1; PSA; hK3; prostate-specific antigen; P-30 antigen; gamma-seminoprotein; kallikrein-3; semenogelase; seminin; kallikrein related peptidase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgggtcccggttgtcttcctcaccctgtccgtgacgtggattggtgctgcacccctcatcctgtctcggattgtgggaggctgggagtgcgagaagcattcccaaccctggcaggtgcttgtggcctctcgtggcagggcagtctgcggcggtgttctggtgcacccccagtgggtcctcacagctgcccactgcatcaggaacaaaagcgtgatcttgctgggtcggcacagcctgtttcatcctgaagacacaggccaggtatttcaggtcagccacagcttcccacacccgctctacgatatgagcctcctgaagaatcgattcctcaggccaggtgatgactccagccacgacctcatgctgctccgcctgtcagagcctgccgagctcacggatgctgtgaaggtcatggacctgcccacccaggagccagcactggggaccacctgctacgcctcaggctggggcagcattgaaccagaggagttcttgaccccaaagaaacttcagtgtgtggacctccatgttatttccaatgacgtgtgtgcgcaagttcaccctcagaaggtgaccaagttcatgctgtgtgctggacgctggacagggggcaaaagcacctgctcgggtgattctgggggcccacttgtctgtaatggtgtgcttcaaggtatcacgtcatggggcagtgaaccatgtgccctgcccgaaaggccttccctgtacaccaaggtggtgcattaccggaagtggatcaaggacaccatcgtggccaacccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: