KLK3-kallikrein-related peptidase 3 Gene View larger

KLK3-kallikrein-related peptidase 3 Gene

PTXBC050595

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KLK3-kallikrein-related peptidase 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KLK3-kallikrein-related peptidase 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050595
Product type: DNA & cDNA
Ncbi symbol: KLK3
Origin species: Human
Product name: KLK3-kallikrein-related peptidase 3 Gene
Size: 2ug
Accessions: BC050595
Gene id: 354
Gene description: kallikrein-related peptidase 3
Synonyms: APS; KLK2A1; PSA; hK3; prostate-specific antigen; P-30 antigen; gamma-seminoprotein; kallikrein-3; semenogelase; seminin; kallikrein related peptidase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgggtcccggttgtcttcctcaccctgtccgtgacgtggattggtgctgcacccctcatcctgtctcggattgtgggaggctgggagtgcgagaagcattcccaaccctggcaggtgcttgtggcctctcgtggcagggcagtctgcggcggtgttctggtgcacccccagtgggtcctcacagctgcccactgcatcaggaacaaaagcgtgatcttgctgggtcggcacagcctgtttcatcctgaagacacaggccaggtatttcaggtcagccacagcttcccacacccgctctacgatatgagcctcctgaagaatcgattcctcaggccaggtgatgactccagccacgacctcatgctgctccgcctgtcagagcctgccgagctcacggatgctgtgaaggtcatggacctgcccacccaggagccagcactggggaccacctgctacgcctcaggctggggcagcattgaaccagaggagttcttgaccccaaagaaacttcagtgtgtggacctccatgttatttccaatgacgtgtgtgcgcaagttcaccctcagaaggtgaccaagttcatgctgtgtgctggacgctggacagggggcaaaagcacctgctcgggtgattctgggggcccacttgtctgtaatggtgtgcttcaaggtatcacgtcatggggcagtgaaccatgtgccctgcccgaaaggccttccctgtacaccaaggtggtgcattaccggaagtggatcaaggacaccatcgtggccaacccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - spermatogenesis associated 3
- TBC1 domain family, member 7
- muscleblind-like (Drosophila)
- FCH and double SH3 domains 1

Buy KLK3-kallikrein-related peptidase 3 Gene now

Add to cart