THAP5-THAP domain containing 5 Gene View larger

THAP5-THAP domain containing 5 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of THAP5-THAP domain containing 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about THAP5-THAP domain containing 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC053634
Product type: DNA & cDNA
Ncbi symbol: THAP5
Origin species: Human
Product name: THAP5-THAP domain containing 5 Gene
Size: 2ug
Accessions: BC053634
Gene id: 168451
Gene description: THAP domain containing 5
Synonyms: THAP domain-containing protein 5; THAP domain containing 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttaactcttaatctagttaaacaacatactgggaaaccagaatctaccttggaaacatcagttaaccaagatacaggtagaggtggttttcacacatgttttgagaatctaaattctacaactattactttgacaacttcaaattcagaaagtattcatcaatctttggaaactcaagaagttcttgaagtaactaccagtcatcttgctaatccaaactttacaagtaattccatggaaataaagtcagcacaggaaaatccattcttattcagcacaattaatcaaacagttgaagaattaaacacaaataaagaatctgttattgccatttttgtacctgctgaaaattctaaaccctcagttaattcttttatatctgcacaaaaagaaaccacggaaatggaagacacagacattgaagactccttgtataaggatgtagactatgggacagaagttttacaaatcgaacattcttactgcagacaagatataaataaggaacatctttggcagaaagtctctaagctacattcaaagataactcttctagagttaaaagagcaacaaactctaggtagattgaagtctttggaagctcttataaggcagctaaagcaggaaaactggctatctgaagaaaacgtcaagattatagaaaaccattttacaacatatgaagtcactatgatatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - HCLS1 binding protein 3
- INO80 complex subunit E
- HCLS1 binding protein 3
- INO80 complex subunit B

Buy THAP5-THAP domain containing 5 Gene now

Add to cart