> >>NOP16-NOP16 nucleolar protein homolog (yeast) Gene
NOP16-NOP16 nucleolar protein homolog (yeast) Gene View larger

NOP16-NOP16 nucleolar protein homolog (yeast) Gene

PTXBC040106

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of NOP16-NOP16 nucleolar protein homolog (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NOP16-NOP16 nucleolar protein homolog (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC040106
Product type: DNA & cDNA
Ncbi symbol: NOP16
Origin species: Human
Product name: NOP16-NOP16 nucleolar protein homolog (yeast) Gene
Size: 2ug
Accessions: BC040106
Gene id: 51491
Gene description: NOP16 nucleolar protein homolog (yeast)
Synonyms: NOP16 nucleolar protein; NOP16 nucleolar protein homolog; HSPC111; HSPC185; nucleolar protein 16; HBV pre-S2 trans-regulated protein 3; nucleolar protein 16 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccaaggccaagggcaaaacccggaggcagaagtttggttacagtgtcaaccgaaagcgtctgaaccggaatgctcgacggaaggcagcgccgcggatcgaatgctcccacatccgacatgcctgggaccacgctaaatcggtacggcagaacctggccgagatggggttggctgtggaccccaacagggcggtgcccctccgtaagagaaaggtgaaggccatggaggtggacatagaggagaggcctaaagagcttgtacggaagccctatgtgctgaatgacctggaggcagaagccagccttccagaaaagaaaggaaatactctgtctcgggacctcattgactatgtacgctacatggtagagaaccacggggaggactataaggccatggcccgtgatgagaagaattactatcaagataccccaaaacagattcggagtaagatcaacgtctataaacgcttttacccagcagagtggcaagacttcctcgattctttgcagaagaggaagatggaggtggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LSM14B, SCD6 homolog B (S. cerevisiae)
- cytochrome b-561 domain containing 2
- Rho guanine exchange factor (GEF) 16
- Fanconi anemia, complementation group L

Reviews

Buy NOP16-NOP16 nucleolar protein homolog (yeast) Gene now

Add to cart