CYB561D2-cytochrome b-561 domain containing 2 Gene View larger

CYB561D2-cytochrome b-561 domain containing 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYB561D2-cytochrome b-561 domain containing 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CYB561D2-cytochrome b-561 domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC047691
Product type: DNA & cDNA
Ncbi symbol: CYB561D2
Origin species: Human
Product name: CYB561D2-cytochrome b-561 domain containing 2 Gene
Size: 2ug
Accessions: BC047691
Gene id: 11068
Gene description: cytochrome b-561 domain containing 2
Synonyms: 101F6; TSP10; XXcos-LUCA11.4; cytochrome b561 domain-containing protein 2; cytochrome b561 family member D2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctttctgcggagaccgagtcacacatctaccgagctctgcgtactgcttctggcgctgccgcccaccttgtggccctgggctttaccatctttgtggctgtgcttgccaggcctggctccagcctgttctcctggcacccggtgcttatgtctttggctttctccttcctgatgaccgaggcactactggtgttttctcctgagagttcgctgctgcactccctctcacggaaaggccgagcacgctgccactgggtgctgcagctgctggccctgctgtgtgcactgctgggcctcggccttgtcatcctccacaaagagcagcttggcaaagcccacctggttacgcggcatgggcaggcagggctgctggctgtgctgtgggcagggctgcagtgctcaggtggggtggggctgctctaccccaagctgctgccccgatggcccctggcgaagctcaagctataccatgctacttctgggctggtgggctacctgctgggtagtgccagcctcttgctgggcatgtgctcactctggttcactgcctctgtcactggtgcagcctggtacctggctgtattatgccctgtcctcaccagcttggtcattatgaaccaggtgagcaatgcctacctataccgcaagaggatccaaccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Rho guanine exchange factor (GEF) 16
- Fanconi anemia, complementation group L
- SUMO1/sentrin/SMT3 specific peptidase 2
- putative neuronal cell adhesion molecule

Buy CYB561D2-cytochrome b-561 domain containing 2 Gene now

Add to cart