ARHGEF16-Rho guanine exchange factor (GEF) 16 Gene View larger

ARHGEF16-Rho guanine exchange factor (GEF) 16 Gene

PTXBC051838

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARHGEF16-Rho guanine exchange factor (GEF) 16 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARHGEF16-Rho guanine exchange factor (GEF) 16 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC051838
Product type: DNA & cDNA
Ncbi symbol: ARHGEF16
Origin species: Human
Product name: ARHGEF16-Rho guanine exchange factor (GEF) 16 Gene
Size: 2ug
Accessions: BC051838
Gene id: 27237
Gene description: Rho guanine exchange factor (GEF) 16
Synonyms: GEF16; NBR; rho guanine nucleotide exchange factor 16; Rho guanine exchange factor (GEF) 16; Rho guanine nucleotide exchange factor (GEF) 16; ephexin-4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcgagatcctcacgtcggagttctcctaccagcacagcctgagcatcctggtggaggagttcctgcagtccaaggagctgcgggcgaccgtgacccagatggagcaccaccacctcttctccaacatcctggatgtcctgggtgccagtcagaggttcttcgaggacctggagcagcggcacaaggcccaggtgctggtcgaggacatcagtgacatcctggaggagcacgctgagaagcacttccacccctacatcgcctactgctccaacgaggtctaccaacagcgcacgctgcagaagctgataagcagcaacgccgccttccgagaggccctgagagagattgagaggcggccggcgtgcgggggcctgcccatgctctccttcctgatcctccccatgcagcgggtgacccggctgcccctcctgatggatacgctctgcctcaagacccagggccactccgaaaggtacaaggctgccagccgtgcactgaaggccatcagcaagctggtgaggcagtgcaacgagggggcccacaggatggagcgcatggagcagatgtacacgctgcacacacagctggacttcagcaaggtcaagtctctcccactgatctccgcctcccggtggctgctgaagcgcggagagctgttcttagtggaagaaaccggactttttcgaaaaattgccagccggccaacgtgctaccttttcctgttcaacgatgtcctggttgtgaccaagaagaagagcgaggagagctacatggtccaggactacgcccagatgaaccacatccaggtggagaagatagagccgtctgagctccctctgcccgggggcggcaaccgtagctcctccgtgccccaccccttccaggtgaccctgcttcgcaacagcgagggccgccaggagcagctcctgctctcctcggactccgcgagtgaccgggcacggtggatcgtggcgctcacacacagtgagagacagtggcagggcctctccagcaaaggagacctgccccaggtggagatcaccaaggccttcttcgcgaagcaagcagacgaggtcacactgcagcaggcggacgtggtcctggttctgcagcaggaggatgggtggctctatggcgagaggctccgggacggagagacgggatggttccccgaggactttgcccgcttcatcaccagccgtgtggccgtggagggcaatgtccgcaggatggagcgtctgcgggtggagacggacgtgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Fanconi anemia, complementation group L
- SUMO1/sentrin/SMT3 specific peptidase 2
- putative neuronal cell adhesion molecule
- zinc finger and BTB domain containing 1

Buy ARHGEF16-Rho guanine exchange factor (GEF) 16 Gene now

Add to cart