Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LSM14B-LSM14B, SCD6 homolog B (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LSM14B-LSM14B, SCD6 homolog B (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC057387 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LSM14B |
| Origin species: | Human |
| Product name: | LSM14B-LSM14B, SCD6 homolog B (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC057387 |
| Gene id: | 149986 |
| Gene description: | LSM14B, SCD6 homolog B (S. cerevisiae) |
| Synonyms: | LSM14B, SCD6 homolog B; C20orf40; FAM61B; FT005; LSM13; RAP55B; bA11M20.3; protein LSM14 homolog B; LSM14 homolog B; RNA-associated protein 55B; family with sequence similarity 61, member B; hRAP55B; LSM family member 14B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcggctcctcaggcaccccgtatctgggcagcaagatcagcctcatctccaaggcgcagatccgctacgagggcattctctacaccatcgacaccgacaactccaccgtggcgctcgccaaagtgaggtcctttggcactgaagaccgtcccacagataggcctgcgccccccagagaggagatttatgagtacatcattttccgaggaagtgacatcaaggatatcactgtgtgtgaacctccgaaagctcagcacacactcccgcaggatcccgccattgttcagtcttccctgggttctgcctccgcctcgcccttccagccgcacgtgccttacagccctttccgagggatggcgccctacggcccgctggcggccagctccctgctcagccagcagtatgccgcctccctgggtctagagaagttggtaagccctccagcctcagccgctgcttccagccctagctcttctccatctccacagcccgtttcagagcttgacttgtcctcagagccacagcagctcactgccaagggtaacagcagtttgggagaactgcatgctgtcttgcaaaccattctgagagcgaggggtaaagcagcagacagaatgacagtagctgtagcagatcatttgccaagcccatgcagccgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome b-561 domain containing 2 - Rho guanine exchange factor (GEF) 16 - Fanconi anemia, complementation group L - SUMO1/sentrin/SMT3 specific peptidase 2 |