LSM14B-LSM14B, SCD6 homolog B (S. cerevisiae) Gene View larger

LSM14B-LSM14B, SCD6 homolog B (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LSM14B-LSM14B, SCD6 homolog B (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LSM14B-LSM14B, SCD6 homolog B (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC057387
Product type: DNA & cDNA
Ncbi symbol: LSM14B
Origin species: Human
Product name: LSM14B-LSM14B, SCD6 homolog B (S. cerevisiae) Gene
Size: 2ug
Accessions: BC057387
Gene id: 149986
Gene description: LSM14B, SCD6 homolog B (S. cerevisiae)
Synonyms: LSM14B, SCD6 homolog B; C20orf40; FAM61B; FT005; LSM13; RAP55B; bA11M20.3; protein LSM14 homolog B; LSM14 homolog B; RNA-associated protein 55B; family with sequence similarity 61, member B; hRAP55B; LSM family member 14B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcggctcctcaggcaccccgtatctgggcagcaagatcagcctcatctccaaggcgcagatccgctacgagggcattctctacaccatcgacaccgacaactccaccgtggcgctcgccaaagtgaggtcctttggcactgaagaccgtcccacagataggcctgcgccccccagagaggagatttatgagtacatcattttccgaggaagtgacatcaaggatatcactgtgtgtgaacctccgaaagctcagcacacactcccgcaggatcccgccattgttcagtcttccctgggttctgcctccgcctcgcccttccagccgcacgtgccttacagccctttccgagggatggcgccctacggcccgctggcggccagctccctgctcagccagcagtatgccgcctccctgggtctagagaagttggtaagccctccagcctcagccgctgcttccagccctagctcttctccatctccacagcccgtttcagagcttgacttgtcctcagagccacagcagctcactgccaagggtaacagcagtttgggagaactgcatgctgtcttgcaaaccattctgagagcgaggggtaaagcagcagacagaatgacagtagctgtagcagatcatttgccaagcccatgcagccgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome b-561 domain containing 2
- Rho guanine exchange factor (GEF) 16
- Fanconi anemia, complementation group L
- SUMO1/sentrin/SMT3 specific peptidase 2

Buy LSM14B-LSM14B, SCD6 homolog B (S. cerevisiae) Gene now

Add to cart