Login to display prices
Login to display prices
LSM14B-LSM14B, SCD6 homolog B (S. cerevisiae) Gene View larger

LSM14B-LSM14B, SCD6 homolog B (S. cerevisiae) Gene

PTXBC057387

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LSM14B-LSM14B, SCD6 homolog B (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LSM14B-LSM14B, SCD6 homolog B (S. cerevisiae) Gene

Proteogenix catalog: PTXBC057387
Ncbi symbol: LSM14B
Product name: LSM14B-LSM14B, SCD6 homolog B (S. cerevisiae) Gene
Size: 2ug
Accessions: BC057387
Gene id: 149986
Gene description: LSM14B, SCD6 homolog B (S. cerevisiae)
Synonyms: LSM14B, SCD6 homolog B; C20orf40; FAM61B; FT005; LSM13; RAP55B; bA11M20.3; protein LSM14 homolog B; LSM14 homolog B; RNA-associated protein 55B; family with sequence similarity 61, member B; hRAP55B; LSM family member 14B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcggctcctcaggcaccccgtatctgggcagcaagatcagcctcatctccaaggcgcagatccgctacgagggcattctctacaccatcgacaccgacaactccaccgtggcgctcgccaaagtgaggtcctttggcactgaagaccgtcccacagataggcctgcgccccccagagaggagatttatgagtacatcattttccgaggaagtgacatcaaggatatcactgtgtgtgaacctccgaaagctcagcacacactcccgcaggatcccgccattgttcagtcttccctgggttctgcctccgcctcgcccttccagccgcacgtgccttacagccctttccgagggatggcgccctacggcccgctggcggccagctccctgctcagccagcagtatgccgcctccctgggtctagagaagttggtaagccctccagcctcagccgctgcttccagccctagctcttctccatctccacagcccgtttcagagcttgacttgtcctcagagccacagcagctcactgccaagggtaacagcagtttgggagaactgcatgctgtcttgcaaaccattctgagagcgaggggtaaagcagcagacagaatgacagtagctgtagcagatcatttgccaagcccatgcagccgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: