Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PILRB-paired immunoglobin-like type 2 receptor beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PILRB-paired immunoglobin-like type 2 receptor beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC050547 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PILRB |
| Origin species: | Human |
| Product name: | PILRB-paired immunoglobin-like type 2 receptor beta Gene |
| Size: | 2ug |
| Accessions: | BC050547 |
| Gene id: | 29990 |
| Gene description: | paired immunoglobin-like type 2 receptor beta |
| Synonyms: | FDFACT1; FDFACT2; paired immunoglobulin-like type 2 receptor beta; activating receptor PILR-beta; activating receptor PILRbeta; cell surface receptor FDFACT; cell surface receptor FDFACT1; cell surface receptor FDFACT2; paired immunoglobin-like receptor beta; paired immunoglobulin-like receptor beta; paired immunoglobin-like type 2 receptor beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtcggcccctgctgctgcccctgctgctcctgctgcagccgccagcatttctgcagcctggtggctccacaggatctggtccaagctacctttatggggtcactcaaccaaaacacctctcagcctccatgggtggctctgtggaaatccccttctccttctattacccctgggagttagccatagttcccaacgtgagaatatcctggagacggggccacttccacgggcagtccttctacagcacaaggccgccttccattcacaaggattatgtgaaccggctctttctgaactggacagagggtcaggagagcggcttcctcaggatctcaaacctgcggaaggaggaccagtctgtgtatttctgccgagtcgagctggacacccggagatcagggaggcagcagttgcagtccatcaaggggaccaaactcaccatcacccaggctgtcacaaccaccaccacctggaggcccagcagcacaaccaccatagccggcctcagggtcacagaaagcaaagggcactcagaatcatggcacctaagtctggacactgccatcagggttgcattggctgtcgctgtgctcaaaactgtcattttgggactgctgtgcctcctcctcctgtggtggaggagaaggaaaggtagcagggcgccaagcagtgacttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor suppressing subtransferable candidate 4 - dynein, axonemal, light intermediate chain 1 - zinc finger, RAN-binding domain containing 2 - purinergic receptor P2Y, G-protein coupled, 8 |