Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DNALI1-dynein, axonemal, light intermediate chain 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNALI1-dynein, axonemal, light intermediate chain 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC046117 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNALI1 |
| Origin species: | Human |
| Product name: | DNALI1-dynein, axonemal, light intermediate chain 1 Gene |
| Size: | 2ug |
| Accessions: | BC046117 |
| Gene id: | 7802 |
| Gene description: | dynein, axonemal, light intermediate chain 1 |
| Synonyms: | P28; dJ423B22.5; hp28; axonemal dynein light intermediate polypeptide 1; dJ423B22.5 (axonemal dynein light chain (hp28)); dynein, axonemal, light intermediate polypeptide 1; inner dynein arm light chain, axonemal; inner dynein arm, homolog of clamydomonas; dynein axonemal light intermediate chain 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgattccgcccgcagactctttgctcaagtacgacaccccagtgctggtgagccggaacacggagaaacggagccccaaggctcggctactgaaagtcagcccccagcagcctggaccttcaggttcagccccacagccacccaagaccaagctcccctcaactccctgtgtcccagatcctacaaagcaggcagaagaaatcttgaatgccatactacccccaagggagtgggtggaagacacgcagctatggatccagcaggtgtccagcacccctagcaccaggatggacgtggtgcacctccaggagcagttagacttaaagctgcagcagcggcaggccagggaaacaggcatctgccctgtccgcagggaactctactcacagtgttttgatgagttgatccgggaggtcaccatcaactgtgcggagagggggctgctgctgctgcgagtccgggacgagatccgcatgaccatcgctgcctaccagaccctgtacgagagcagcgtggcgtttggcatgaggaaggcactgcaggctgagcaggggaagtcagacatggagaggaaaatcgcagaattggagacggaaaagagagacctggagaggcaagtgaacgagcagaaggcaaaatgtgaagccactgagaagcgggagagcgagaggcggcaggtggaggagaagaagcacaatgaggagattcagttcctgaagcgaacaaatcagcagctgaaggcccaactggaaggcattattgcaccaaagaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger, RAN-binding domain containing 2 - purinergic receptor P2Y, G-protein coupled, 8 - bone morphogenetic protein receptor, type IB - family with sequence similarity 35, member A |