Login to display prices
Login to display prices
DNALI1-dynein, axonemal, light intermediate chain 1 Gene View larger

DNALI1-dynein, axonemal, light intermediate chain 1 Gene

PTXBC046117

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNALI1-dynein, axonemal, light intermediate chain 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DNALI1-dynein, axonemal, light intermediate chain 1 Gene

Proteogenix catalog: PTXBC046117
Ncbi symbol: DNALI1
Product name: DNALI1-dynein, axonemal, light intermediate chain 1 Gene
Size: 2ug
Accessions: BC046117
Gene id: 7802
Gene description: dynein, axonemal, light intermediate chain 1
Synonyms: P28; dJ423B22.5; hp28; axonemal dynein light intermediate polypeptide 1; dJ423B22.5 (axonemal dynein light chain (hp28)); dynein, axonemal, light intermediate polypeptide 1; inner dynein arm light chain, axonemal; inner dynein arm, homolog of clamydomonas; dynein axonemal light intermediate chain 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattccgcccgcagactctttgctcaagtacgacaccccagtgctggtgagccggaacacggagaaacggagccccaaggctcggctactgaaagtcagcccccagcagcctggaccttcaggttcagccccacagccacccaagaccaagctcccctcaactccctgtgtcccagatcctacaaagcaggcagaagaaatcttgaatgccatactacccccaagggagtgggtggaagacacgcagctatggatccagcaggtgtccagcacccctagcaccaggatggacgtggtgcacctccaggagcagttagacttaaagctgcagcagcggcaggccagggaaacaggcatctgccctgtccgcagggaactctactcacagtgttttgatgagttgatccgggaggtcaccatcaactgtgcggagagggggctgctgctgctgcgagtccgggacgagatccgcatgaccatcgctgcctaccagaccctgtacgagagcagcgtggcgtttggcatgaggaaggcactgcaggctgagcaggggaagtcagacatggagaggaaaatcgcagaattggagacggaaaagagagacctggagaggcaagtgaacgagcagaaggcaaaatgtgaagccactgagaagcgggagagcgagaggcggcaggtggaggagaagaagcacaatgaggagattcagttcctgaagcgaacaaatcagcagctgaaggcccaactggaaggcattattgcaccaaagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: