Login to display prices
Login to display prices
ZRANB2-zinc finger, RAN-binding domain containing 2 Gene View larger

ZRANB2-zinc finger, RAN-binding domain containing 2 Gene

PTXBC039814

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZRANB2-zinc finger, RAN-binding domain containing 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZRANB2-zinc finger, RAN-binding domain containing 2 Gene

Proteogenix catalog: PTXBC039814
Ncbi symbol: ZRANB2
Product name: ZRANB2-zinc finger, RAN-binding domain containing 2 Gene
Size: 2ug
Accessions: BC039814
Gene id: 9406
Gene description: zinc finger, RAN-binding domain containing 2
Synonyms: ZIS; ZIS1; ZIS2; zinc finger Ran-binding domain-containing protein 2; zinc finger protein 265; zinc finger, RAN-binding domain containing 2; zinc-finger, splicing; zinc finger RANBP2-type containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgaccaagaatttccgagtcagtgacggggactggatttgccctgacaaaaaatgtggaaatgtaaactttgctagaagaaccagctgtaatcgatgtggtcgggagaaaacaactgaggccaagatgatgaaagctgggggcactgaaataggaaagacacttgcagaaaagagccgaggcctatttagtgctaatgactggcaatgtaaaacttgcagcaatgtgaattgggccagaagatcagagtgtaatatgtgtaatactccaaagtatgctaaattagaagaaagaacaggatatggtggtggttttaatgaaagagaaaatgttgaatatatagaaagagaagaatctgatggtgaatatgatgagtttggacgtaaaaagaaaaaatacagagggaaagcagttggtcctgcatctatattaaaggaagttgaagataaagaatcagagggagaagaagaggatgaggatgaagatctttctaaatataagttagatgaggatgaggatgaagatgacgctgatctctcaaaatataatcttgatgccagtgaagaagaagatagtaataaaaagaaatctaatagacgaagtcgctcaaagtctggatcttcacattcacgatcttcatcacgctcatcctccccctcaagttcaaggtctaggtccaggtcccgttcaagaagttcttccagttcgcagtcaagatctcgttccagttccagagaacgttcgagatctcgtgggtcgaaatcaagatccagctccaggtcccacaggggctcttcttccccacgaaaaagatcttattcaagttcatcatcttctcctgagaggaacagaaagagaagtcgttctagatcttcttcatctggtgatcgcaaaaaaagacgaacaagatcacggtcacccgaaagccaggtgattggtgaaaacactaaacaaccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: