PTXBC061903
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC061903 |
Product type: | DNA & cDNA |
Ncbi symbol: | ISCU |
Origin species: | Human |
Product name: | ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene |
Size: | 2ug |
Accessions: | BC061903 |
Gene id: | 23479 |
Gene description: | iron-sulfur cluster scaffold homolog (E. coli) |
Synonyms: | IscU iron-sulfur cluster scaffold homolog; iron-sulfur cluster assembly enzyme ISCU, mitochondrial; 2310020H20Rik; HML; ISU2; NIFU; NIFUN; hnifU; nifU-like N-terminal domain-containing protein; iron-sulfur cluster assembly enzyme |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcggcggctggggctttccgtctgaggcgggcggcatcggctctgctgctgcggagcccccgcctgcccgcccgggagctgtcggccccggcccgactctatcacaagaaggttgttgatcattatgaaaatcctagaaacgtggggtcccttgacaagacatctaaaaatgttggaactggactggtgggggctccagcatgtggtgacgtaatgaaattacagattcaagtggatgaaaaggggaagattgtggatgctaggtttaaaacatttggctgtggttccgcaattgcctccagctcattagccactgaatgggtgaaaggaaagacggtggaggaagccttgactatcaaaaacacagatatcgccaaggagctctgccttcctcccgtgaaactgcactgctccatgctggctgaagatgcaatcaaggccgccctggctgattacaaattgaaacaagaacccaaaaaaggagaggcagagaagaaatga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - family with sequence similarity 54, member A - dehydrogenase/reductase (SDR family) member 9 - transmembrane and coiled-coil domain family 2 - tubulointerstitial nephritis antigen-like 1 |