Cart 7 Product Products 961,25 € (empty)
-
1 x KRT80-kera...121,50 € -
1 x FGF14-fibr...113,40 € -
1 x ZRANB2-zin...121,50 € -
1 x Plant GST...259,07 € -
1 x TNFAIP2-tu...121,50 € -
-
1 x GPRC5D-G...121,50 €
No products
To be determined Shipping
961,25 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 961,25 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 961,25 €
View larger 
Data sheet of ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC061903 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ISCU |
| Origin species: | Human |
| Product name: | ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene |
| Size: | 2ug |
| Accessions: | BC061903 |
| Gene id: | 23479 |
| Gene description: | iron-sulfur cluster scaffold homolog (E. coli) |
| Synonyms: | IscU iron-sulfur cluster scaffold homolog; iron-sulfur cluster assembly enzyme ISCU, mitochondrial; 2310020H20Rik; HML; ISU2; NIFU; NIFUN; hnifU; nifU-like N-terminal domain-containing protein; iron-sulfur cluster assembly enzyme |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggctggggctttccgtctgaggcgggcggcatcggctctgctgctgcggagcccccgcctgcccgcccgggagctgtcggccccggcccgactctatcacaagaaggttgttgatcattatgaaaatcctagaaacgtggggtcccttgacaagacatctaaaaatgttggaactggactggtgggggctccagcatgtggtgacgtaatgaaattacagattcaagtggatgaaaaggggaagattgtggatgctaggtttaaaacatttggctgtggttccgcaattgcctccagctcattagccactgaatgggtgaaaggaaagacggtggaggaagccttgactatcaaaaacacagatatcgccaaggagctctgccttcctcccgtgaaactgcactgctccatgctggctgaagatgcaatcaaggccgccctggctgattacaaattgaaacaagaacccaaaaaaggagaggcagagaagaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 54, member A - dehydrogenase/reductase (SDR family) member 9 - transmembrane and coiled-coil domain family 2 - tubulointerstitial nephritis antigen-like 1 |