Cart 13 Product Products 3 133,50 € (empty)
-
-
-
-
-
-
-
-
-
1 x PAPD4-PAP...121,50 € -
-
-
-
No products
To be determined Shipping
3 133,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 133,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 133,50 €
View larger 
Data sheet of TSSC4-tumor suppressing subtransferable candidate 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TSSC4-tumor suppressing subtransferable candidate 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC050616 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TSSC4 |
| Origin species: | Human |
| Product name: | TSSC4-tumor suppressing subtransferable candidate 4 Gene |
| Size: | 2ug |
| Accessions: | BC050616 |
| Gene id: | 10078 |
| Gene description: | tumor suppressing subtransferable candidate 4 |
| Synonyms: | protein TSSC4; tumor-suppressing STF cDNA 4 protein; tumor-suppressing subchromosomal transferable fragment candidate gene 4 protein; tumor suppressing subtransferable candidate 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgaggcaggaacaggcctcctcccagccacggtgcagccattccatctgagaggcatgagctccaccttctcccagcgcagccgtgacatctttgactgcctggagggggcggccagacgggctccatcctctgtggcccacaccagcatgagtgacaacggaggcttcaagcggcccctagcgccctcaggccggtctccagtggaaggcctgggcagggcccatcggagccctgcctcaccaagggtgcctccggtccccgactacgtggcacaccccgagcgctggaccaagtacagcctggaagatgtgaccgaggtcagcgagcagagcaatcaggccaccgccctggccttcctgggctcccagagcctggctgcccccactgactgcgtgtcctccttcaaccaggatccctccagctgtggggaggggagggtcatcttcaccaaaccagtccgaggggtcgaagccagacacgagaggaagagggtcctggggaaggtgggagagccaggcaggggcggccttgggaatcctgccacagacaggggcgagggccctgtggagctggcccatctggccgggcccgggagcccagaggctgaggagtggggcagcccccatggaggcctgcaggaggtggaggcactgtcagggtctgtccacagtgggtctgtgccaggtctcccgccggtggaaactgttggcttccatggcagcaggaagcggagtcgagaccacttccggaacaagagcagcagccccgaggacccaggtgctgaggtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dynein, axonemal, light intermediate chain 1 - zinc finger, RAN-binding domain containing 2 - purinergic receptor P2Y, G-protein coupled, 8 - bone morphogenetic protein receptor, type IB |