No products
Prices are tax excluded
PTXBC053369
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC053369 |
Product type: | DNA & cDNA |
Ncbi symbol: | SPINLW1 |
Origin species: | Human |
Product name: | SPINLW1-serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin) Gene |
Size: | 2ug |
Accessions: | BC053369 |
Gene id: | 57119 |
Gene description: | serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin) |
Synonyms: | SPINLW1; CT71; CT72; WAP7; WFDC7; dJ461P17.2; WAP four-disulfide core domain protein 7; cancer/testis antigen 71; cancer/testis antigen 72; epididymal protease inhibitor; protease inhibitor WAP7; serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin); epididymal peptidase inhibitor |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgggatcttctggacttttgagcctcctggtgctattcgtcctcttagcgaatgtccagggacctggtctgactgattggttatttcccaggagatgtcccaaaatcagagaagaatgtgaattccaagaaagggatgtgtgtacaaaggacagacaatgccaggacaacaagaagtgttgtgtcttcagctgcggaaaaaaatgtttagatctcaaacaagatgtatgcgaaatgccaaaagaaactggcccctgcctggcttattttcttcattggtggtatgacaagaaagataatacttgctccatgtttgtctatggtggctgccagggaaacaataacaacttccaatccaaagccaactgcctgaacacctgcaagaataaacgctttccctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - solute carrier family 22 (organic anion/urate transporter), member 12 - CD74 molecule, major histocompatibility complex, class II invariant chain - solute carrier family 16, member 10 (aromatic amino acid transporter) - growth arrest and DNA-damage-inducible, gamma interacting protein 1 |