Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC16A10-solute carrier family 16, member 10 (aromatic amino acid transporter) Gene
PTXBC017968
New product
Data sheet of SLC16A10-solute carrier family 16, member 10 (aromatic amino acid transporter) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC16A10-solute carrier family 16, member 10 (aromatic amino acid transporter) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017968 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC16A10 |
| Origin species: | Human |
| Product name: | SLC16A10-solute carrier family 16, member 10 (aromatic amino acid transporter) Gene |
| Size: | 2ug |
| Accessions: | BC017968 |
| Gene id: | 117247 |
| Gene description: | solute carrier family 16, member 10 (aromatic amino acid transporter) |
| Synonyms: | MCT10; PRO0813; TAT1; monocarboxylate transporter 10; MCT 10; T-type amino acid transporter 1; aromatic amino acid transporter 1; solute carrier family 16 (aromatic amino acid transporter), member 10; solute carrier family 16 (monocarboxylic acid transporters), member 10; solute carrier family 16, member 10 (aromatic amino acid transporter); solute carrier family 16 member 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaacatgtaaatgaaagatttcaagatgaaaaaaataaagaggttgttctcatgtgcattggcgtcacttcaggagttggacgactgctctttggccggattgcagattatgtgcctggtgtgaagaaggtttatctacaggtactctcctttttcttcattggtctgatgtccatgatgattcctctgtgtagcatctttggggccctcattgctgtgtgcctcatcatgggtctcttcgatggatgcttcatttccattatggctcccatagcctttgagttagttggtgcccaggatgtctcccaagcaattggacttctgctcggattcatgtctatacccatgactgttggcccacccattgcagggttacttcgtgacaaactgggctcctatgatgtggcattctacctcgctggagtccctccccttattggaggtgctgtgctttgttttatcccgtggatccatagtaagaagcaaagagagatcagtaaaaccactggaaaagaaaagatggagaaaatgttggaaaaccagaactctctgctgtcaagttcatctggaatgttcgagaaagaatctgactctattatttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - growth arrest and DNA-damage-inducible, gamma interacting protein 1 - solute carrier family 16, member 6 (monocarboxylic acid transporter 7) - solute carrier family 16, member 5 (monocarboxylic acid transporter 6) - optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) |