Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
OPA3-optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) Gene
PTXBC005059
New product
Data sheet of OPA3-optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OPA3-optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005059 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OPA3 |
| Origin species: | Human |
| Product name: | OPA3-optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) Gene |
| Size: | 2ug |
| Accessions: | BC005059 |
| Gene id: | 80207 |
| Gene description: | optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) |
| Synonyms: | OPA3, outer mitochondrial membrane lipid metabolism regulator; MGA3; optic atrophy 3 protein; Optic atrophy 3 (Iraqi-Jewish 'optic atrophy plus'); optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggtgggcgcgttccctatggcgaagctgctatacttgggcatccggcaggtcagcaagccgcttgccaaccgtattaaggaggccgcccgccgaagcgagttcttcaagacctatatctgcctcccgccggctcaactgtatcactgggtggagatgcggaccaagatgcgcatcatgggcttccggggcacggtcatcaagccgctgaacgaggaggcggcagccgagctgggcgcagagctgctgggcgaagccaccatcttcatcgtgggcggcggctgcctagtgctggagtactggcgccaccaggcgcagcagcgccacaaggaggaggagcagcgtgctgcctggaacgcgctgcgggacgaggtgggccacctggcgctggcgctggaagcgctgcaggcgcaggtgcaggcggcgccgccacagggcgccctggaggaactgcgcacagagctgcaagaggtgcgcgcccagctctgcaatcccggccggtccgcttcccacgcagtgcctgcgtccaagaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 16, member 3 (monocarboxylic acid transporter 4) - suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein) - solute carrier family 16, member 9 (monocarboxylic acid transporter 9) - solute carrier family 16, member 9 (monocarboxylic acid transporter 9) |