Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC16A3-solute carrier family 16, member 3 (monocarboxylic acid transporter 4) Gene
PTXBC112267
New product
Data sheet of SLC16A3-solute carrier family 16, member 3 (monocarboxylic acid transporter 4) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC16A3-solute carrier family 16, member 3 (monocarboxylic acid transporter 4) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC112267 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC16A3 |
| Origin species: | Human |
| Product name: | SLC16A3-solute carrier family 16, member 3 (monocarboxylic acid transporter 4) Gene |
| Size: | 2ug |
| Accessions: | BC112267 |
| Gene id: | 9123 |
| Gene description: | solute carrier family 16, member 3 (monocarboxylic acid transporter 4) |
| Synonyms: | MCT 3; MCT 4; MCT-3; MCT-4; MCT3; MCT4; monocarboxylate transporter 4; monocarboxylate transporter 3; solute carrier family 16 (monocarboxylate transporter), member 3; solute carrier family 16 (monocarboxylic acid transporters), member 3; solute carrier family 16, member 3 (monocarboxylic acid transporter 4); solute carrier family 16 member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaggggccgtggtggacgagggccccacaggcgtcaaggcccctgacggcggctggggctgggccgtgctcttcggctgtttcgtcatcactggcttctcctacgccttccccaaggccgtcagtgtcttcttcaaggagctcatacaggagtttgggatcggctacagcgacacagcctggatctcctccatcctgctggccatgctctacgggacaggtccgctctgcagtgtgtgcgtgaaccgctttggctgccggcccgtcatgcttgtggggggtctctttgcgtcgctgggcatggtggctgcgtccttttgccggagcatcatccaggtctacctcaccactggggtcatcacggggttgggtttggcactcaacttccagccctcgctcatcatgctgaaccgctacttcagcaagcggcgccccatggccaacgggctggcggcagcaggtagccctgtcttcctgtgtgccctgagcccgctggggcagctgctgcaggaccgctacggctggcggggcggcttcctcatcctgggcggcctgctgctcaactgctgcgtgtgtgccgcactcatgaggcccctggtggtcacggcccagccgggctcggggccgccgcgaccctcccggcgcctgctagacctgagcgtcttccgggaccgcggctttgtgctttacgccgtggccgcctcggtcatggtgctggggctcttcgtcccgcccgtgttcgtggtgagctacgccaaggacctgggcgtgcccgacaccaaggccgccttcctgctcaccatcctgggcttcattgacatcttcgcgcggccggccgcgggcttcgtggcggggcttgggaaggtgcggccctactccgtctacctcttcagcttctccatgttcttcaacggcctcgcggacctggcgggctctacggcgggcgactacggcggcctcgtggtcttctgcatcttctttggcatctcctacggcatggtgggggccctgcagttcgaggtgctcatggccatcgtgggcacccacaagttctccagtgccattggcctggtgctgctgatggaggcggtggccgtgctcgtcgggcccccttcgggaggcaaactcctggatgcgacccacgtctacatgtacgtgttcatcctggcgggggccgaggtgctcacctcctccctgattttgctgctgggcaacttcttctgcattaggaagaagcccaaagagccacagcctgaggtggcggccgcggaggaggagaagctccacaagcctcctgcagactcgggggtggacttgcgggaggtggagcatttcctgaaggctgagcctgagaaaaacggggaggtggttcacaccccggaaacaagtgtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein) - solute carrier family 16, member 9 (monocarboxylic acid transporter 9) - solute carrier family 16, member 9 (monocarboxylic acid transporter 9) - solute carrier family 16, member 1 (monocarboxylic acid transporter 1) |