Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GADD45GIP1-growth arrest and DNA-damage-inducible, gamma interacting protein 1 Gene
PTXBC069200
New product
Data sheet of GADD45GIP1-growth arrest and DNA-damage-inducible, gamma interacting protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GADD45GIP1-growth arrest and DNA-damage-inducible, gamma interacting protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069200 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GADD45GIP1 |
| Origin species: | Human |
| Product name: | GADD45GIP1-growth arrest and DNA-damage-inducible, gamma interacting protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC069200 |
| Gene id: | 90480 |
| Gene description: | growth arrest and DNA-damage-inducible, gamma interacting protein 1 |
| Synonyms: | CKBBP2; CKbetaBP2; CRIF1; MRP-L59; PLINP; PLINP-1; PRG6; Plinp1; growth arrest and DNA damage-inducible proteins-interacting protein 1; 39S ribosomal protein L59, mitochondrial; CKII beta binding protein 2; CKII beta-associating protein; CR6 interacting factor 1; growth arrest and DNA-damage-inducible, gamma interacting protein 1; growth arrest- and DNA damage-inducible GADD45G-interacting protein; p53-responsive gene 6 protein; papillomavirus L2 interacting nuclear protein 1; GADD45G interacting protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgtccgtgcgacaggcacgcagcctactaggtgtggcggcgaccctggccccgggttcccgtggctaccgggcgcggccgcccccgcgccgcaggccgggaccccggtggccagaccccgaggacctcctgaccccgcggtggcagctgggaccgcgctacgcggctaagcagttcgcgcgttacggcgccgcctccggggtggtccccggttcgttatggccgtcgccggagcagctgcgggagctggaggccgaagaacgcgaatggtacccgagcctggcgaccatgcaggagtcgctgcgggtgaagcagctggccgaagagcagaagcgtcgggagagggagcagcacatcgcagagtgcatggccaagatgccacagatgattgtgaactggcagcagcagcagcgggagaactgggagaaggcccaggctgacaaggagaggagggcccgactgcaggctgaggcccaggagctcctgggctaccaggtggacccaaggagtgcccgcttccaggagctgctccaggacctagagaagaaggagcgcaagcgcctcaaggaggaaaaacagaaacggaagaaggaggcgcgagctgctgcattggctgcagctgtggctcaagacccagcagcctctggggcacccagctcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 16, member 6 (monocarboxylic acid transporter 7) - solute carrier family 16, member 5 (monocarboxylic acid transporter 6) - optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) - solute carrier family 16, member 3 (monocarboxylic acid transporter 4) |