Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CD74-CD74 molecule, major histocompatibility complex, class II invariant chain Gene
PTXBC018726
New product
Data sheet of CD74-CD74 molecule, major histocompatibility complex, class II invariant chain Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD74-CD74 molecule, major histocompatibility complex, class II invariant chain Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018726 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD74 |
| Origin species: | Human |
| Product name: | CD74-CD74 molecule, major histocompatibility complex, class II invariant chain Gene |
| Size: | 2ug |
| Accessions: | BC018726 |
| Gene id: | 972 |
| Gene description: | CD74 molecule, major histocompatibility complex, class II invariant chain |
| Synonyms: | CD74 molecule; CD74 molecule, major histocompatibility complex, class II invariant chain; CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated); DHLAG; HLADG; Ia-GAMMA; HLA class II histocompatibility antigen gamma chain; HLA-DR antigens-associated invariant chain; HLA-DR-gamma; Ia-associated invariant chain; MHC HLA-DR gamma chain; gamma chain of class II antigens; p33 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcacaggaggagaagcaggagctgtcgggaagatcagaagccagtcatggatgaccagcgcgaccttatctccaacaatgagcaactgcccatgctgggccggcgccctggggccccggagagcaagtgcagccgcggagccctgtacacaggcttttccatcctggtgactctgctcctcgctggccaggccaccaccgcctacttcctgtaccagcagcagggccggctggacaaactgacagtcacctcccagaacctgcagctggagaacctgcgcatgaagcttcccaagcctcccaagcctgtgagcaagatgcgcatggccaccccgctgctgatgcaggcgctgcccatgggagccctgccccaggggcccatgcagaatgccaccaagtatggcaacatgacagaggaccatgtgatgcacctgctccagaatgctgaccccctgaaggtgtacccgccactgaaggggagcttcccggagaacctgagacaccttaagaacaccatggagaccatagactggaaggtctttgagagctggatgcaccattggctcctgtttgaaatgagcaggcactccttggagcaaaagcccactgacgctccaccgaaagagtcactggaactggaggacccgtcttctgggctgggtgtgaccaagcaggatctgggcccagtccccatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 16, member 10 (aromatic amino acid transporter) - growth arrest and DNA-damage-inducible, gamma interacting protein 1 - solute carrier family 16, member 6 (monocarboxylic acid transporter 7) - solute carrier family 16, member 5 (monocarboxylic acid transporter 6) |