Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CWC15-CWC15 spliceosome-associated protein homolog (S. cerevisiae) Gene
PTXBC040946
New product
Data sheet of CWC15-CWC15 spliceosome-associated protein homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CWC15-CWC15 spliceosome-associated protein homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC040946 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CWC15 |
| Origin species: | Human |
| Product name: | CWC15-CWC15 spliceosome-associated protein homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC040946 |
| Gene id: | 51503 |
| Gene description: | CWC15 spliceosome-associated protein homolog (S. cerevisiae) |
| Synonyms: | CWC15 spliceosome associated protein homolog; CWC15 spliceosome-associated protein; spliceosome-associated protein CWC15 homolog; AD002; C11orf5; Cwf15; HSPC148; ORF5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacaacagcagccaggccaacctttgaacctgccagaggtggaaggggaaaaggagaaggtgatttgagccaactttcaaagcagtattcaagcagagacctaccctctcatacaaagataaaatacagacagactactcaggatgcccctgaagaggttcgtaaccgtgacttcaggagagagttggaagaaagagagagagctgctgcaagagagaaaaatagggatcgtccaacccgagaacatacaacctcctcttcagtgtcaaaaaagccacggttagaccagattcctgccgccaaccttgatgcagatgaccctctaacagatgaggaagatgaagattttgaagaagaaagtgatgatgatgatactgcagctcttcttgcagaactggaaaaaattaaaaaagaaagagctgaagagcaggccaggaaggaacaagaacaaaaagctgaagaagagaggattcgtatggaaaacattctgagcggaaaccctctccttaatctcactggcccatcccagcctcaggccaacttcaaagttaaaagaaggtgggatgatgacgttgtcttcaagaactgtgcaaaaggtgtagatgaccagaagaaagacaaaagatttgtaaatgacacactgcgatctgaatttcacaaaaagttcatggagaaatatattaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa - protein kinase, AMP-activated, beta 2 non-catalytic subunit - protein phosphatase 1, regulatory (inhibitor) subunit 14A - serpin peptidase inhibitor, clade B (ovalbumin), member 5 |