Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFA3-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa Gene
PTXBC061644
New product
Data sheet of NDUFA3-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFA3-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC061644 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFA3 |
| Origin species: | Human |
| Product name: | NDUFA3-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa Gene |
| Size: | 2ug |
| Accessions: | BC061644 |
| Gene id: | 4696 |
| Gene description: | NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa |
| Synonyms: | CI-B9; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 3; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa; NADH-ubiquinone oxidoreductase B9 subunit; complex I B9 subunit; complex I-B9; NADH:ubiquinone oxidoreductase subunit A3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgcgagagtcggcgccttcctcaagaatgcctgggacaaggagccagtgctggtcgtgtccttcgtcgtcgggggcctcgctgtaattctgcccccattgagcccctacttcaagtactccgtcatgatcaacaaggccacgccctacaactacccagtgcccgtccgtgatgatgggaacatgcccgacgtgcccagccacccccaggaccctcagggccccagcctggagtggctgaagaaactgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein kinase, AMP-activated, beta 2 non-catalytic subunit - protein phosphatase 1, regulatory (inhibitor) subunit 14A - serpin peptidase inhibitor, clade B (ovalbumin), member 5 - LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) |