No products
Prices are tax excluded
PTXBC066922
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066922 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP1R2P3 |
| Origin species: | Human |
| Product name: | PPP1R2P3-protein phosphatase 1, regulatory (inhibitor) subunit 2 pseudogene 3 Gene |
| Size: | 2ug |
| Accessions: | BC066922 |
| Gene id: | 153743 |
| Gene description: | protein phosphatase 1, regulatory (inhibitor) subunit 2 pseudogene 3 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcctcgacggcctcccaccggcccatcaaggggatcttgaagaacaagacctctacgacttcctctatggtggcgtcggccgaacagccccgcaggagtgtcgacgaggagctgagcaaaaaatcccagaagtgggatgaaattaacatcttggcgacctatcatccagcagacaaaggctatggtttaatgaaaatagatgaaccaagccctccttaccatagtatgatgggtgatgatgaagatgcgtgtagggacaccgagaccactgaagccatggcgccaggcatcctagccaagaaattagctgctgctgaaggcttggagccaaagtaccggattcaggaacaagaaagcagtggagaggaggatagtgacctctcacctgaagaacgagaaaaaaagcgacaatttgaaatgagaaggaagcttcactacaatgaaggactcaatatcaaactagccagacaattaatttcaaaagacctacatgatgatgatgaagatgaagaaatgttagagactgcagatggagaaagcatgaatacggaagaatcaaatcaaggatctactccaagtgaccaacagcaaaacaaattacgaagttcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 37 (glycerol-3-phosphate transporter), member 2 - solute carrier family 37 (glycerol-3-phosphate transporter), member 2 - sperm protein associated with the nucleus, X-linked, family member A1 - sperm protein associated with the nucleus, X-linked, family member A1 |