SLC37A2-solute carrier family 37 (glycerol-3-phosphate transporter), member 2 Gene View larger

SLC37A2-solute carrier family 37 (glycerol-3-phosphate transporter), member 2 Gene


New product

Data sheet of SLC37A2-solute carrier family 37 (glycerol-3-phosphate transporter), member 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC37A2-solute carrier family 37 (glycerol-3-phosphate transporter), member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC051314
Product type: DNA & cDNA
Ncbi symbol: SLC37A2
Origin species: Human
Product name: SLC37A2-solute carrier family 37 (glycerol-3-phosphate transporter), member 2 Gene
Size: 2ug
Accessions: BC051314
Gene id: 219855
Gene description: solute carrier family 37 (glycerol-3-phosphate transporter), member 2
Synonyms: glucose-6-phosphate exchanger SLC37A2; pp11662; solute carrier family 37 (glucose-6-phosphate transporter), member 2; solute carrier family 37 (glycerol-3-phosphate transporter), member 2; sugar phosphate exchanger 2; solute carrier family 37 member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggtcctccctggctccgggagtctggttcttccgggccttctccagggacagctggttccgaggcctcatcctgctgctgaccttcctaatttacgcctgctatcacatgtccaggaagcctatcagtatcgtcaagagccgtctgcaccagaactgctcggagcagatcaaacccatcaatgatactcacagtctcaatgacaccatgtggtgcagctgggccccatttgacaaggacaactataaggagttactagggggcgtggacaacgccttcctcatcgcctatgccatcggcatgttcatcagtggggtttttggggagcggcttccgctccgttactacctctcagctggaatgctgctcagtggccttttcacctcgctctttggcctgggatatttctggaacatccacgagctctggtactttgtggtcatccaggtctgtaatggactcgtccagaccacaggctggccctctgtggtgacctgtgttggcaactggttcgggaaggggaagcgggggttcatcatgggcatctggaattcccacacatctgtgggcaacatcctgggctccctgatcgccggcatctgggtgaacgggcagtggggcctgtcgttcatcgtgcctggcatcattactgccgtcatgggcgtcatcaccttcctcttcctcatcgaacacccagaagatgtggactgcgcccctcctcagcaccacggtgagccagctgagaaccaggacaaccctgaggaccctgggaacagtccctgctctatcagggagagcggccttgagactgtggccaaatgctccaaggggccatgcgaagagcctgctgccatcagcttctttggggcgctccggatcccaggcgtggtcgagttctctctgtgtctgctgtttgccaagctggtcagttacaccttcctctactggctgcccctctacatcgccaatgtggctcactttagtgccaaggaggctggggacctgtctacactcttcgatgttggtggcatcataggcggcatcgtggcagggctcgtctctgactacaccaatggcagggccaccacttgctgtgtcatgctcatcttggctgcccccatgatgttcctgtacaactacattggccaggacgggattgccagctccatagtgatgctgatcatctgtgggggcctggtcaatggcccatacgcgctcatcaccactgctgtctctgctgacctggggactcacaagagcctgaagggcaacgccaaagccctgtccacggtcacggccatcattgacggcaccggctccataggtgcggctctggggcctctgctggctgggctcatctcccccacgggctggaacaatgtcttctacatgctcatctctgccgacgtcctagcctgcttgctcctttgccggttagtatacaaagagatcttggcctggaaggtgtccctgagcagaggcagcggctctagtatggtcctaacccaccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sperm protein associated with the nucleus, X-linked, family member A1
- sperm protein associated with the nucleus, X-linked, family member A1
- solute carrier family 37 (glycerol-3-phosphate transporter), member 3
- solute carrier family 4 (anion exchanger), member 1, adaptor protein

Buy SLC37A2-solute carrier family 37 (glycerol-3-phosphate transporter), member 2 Gene now

Add to cart