No products
Prices are tax excluded
PTXBC069816
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069816 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPANXA1 |
| Origin species: | Human |
| Product name: | SPANXA1-sperm protein associated with the nucleus, X-linked, family member A1 Gene |
| Size: | 2ug |
| Accessions: | BC069816 |
| Gene id: | 30014 |
| Gene description: | sperm protein associated with the nucleus, X-linked, family member A1 |
| Synonyms: | CT11.1; NAP-X; SPAN-X; SPAN-Xa; SPAN-Xb; SPANX; SPANX-A; sperm protein associated with the nucleus on the X chromosome A; SPANX family member A; SPANX family, member A1; cancer/testis antigen 11.1; cancer/testis antigen family 11, member 1; nuclear-associated protein SPAN-Xa; sperm protein associated with the nucleus, X chromosome, family member A1; sperm protein associated with the nucleus, X-linked, family member A1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacaaacaatccagtgccggcggggtgaagaggagcgtcccctgtgattccaacgaggccaacgagatgatgccggagaccccaactggggactcagacccgcaacctgctcctaaaaaaatgaaaacatctgagtcctcgaccatactagtggttcgctacaggaggaactttaaaagaacatctccagaggaactgctgaatgaccacgcccgagagaacagaatcaaccccctccaaatggaggaggaggaattcatggaaataatggttgaaatacctgcaaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - sperm protein associated with the nucleus, X-linked, family member A1 - solute carrier family 37 (glycerol-3-phosphate transporter), member 3 - solute carrier family 4 (anion exchanger), member 1, adaptor protein - translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) |