SPANXA1-sperm protein associated with the nucleus, X-linked, family member A1 Gene View larger

SPANXA1-sperm protein associated with the nucleus, X-linked, family member A1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPANXA1-sperm protein associated with the nucleus, X-linked, family member A1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SPANXA1-sperm protein associated with the nucleus, X-linked, family member A1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC069816
Product type: DNA & cDNA
Ncbi symbol: SPANXA1
Origin species: Human
Product name: SPANXA1-sperm protein associated with the nucleus, X-linked, family member A1 Gene
Size: 2ug
Accessions: BC069816
Gene id: 30014
Gene description: sperm protein associated with the nucleus, X-linked, family member A1
Synonyms: CT11.1; NAP-X; SPAN-X; SPAN-Xa; SPAN-Xb; SPANX; SPANX-A; sperm protein associated with the nucleus on the X chromosome A; SPANX family member A; SPANX family, member A1; cancer/testis antigen 11.1; cancer/testis antigen family 11, member 1; nuclear-associated protein SPAN-Xa; sperm protein associated with the nucleus, X chromosome, family member A1; sperm protein associated with the nucleus, X-linked, family member A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacaaacaatccagtgccggcggggtgaagaggagcgtcccctgtgattccaacgaggccaacgagatgatgccggagaccccaactggggactcagacccgcaacctgctcctaaaaaaatgaaaacatctgagtcctcgaccatactagtggttcgctacaggaggaactttaaaagaacatctccagaggaactgctgaatgaccacgcccgagagaacagaatcaaccccctccaaatggaggaggaggaattcatggaaataatggttgaaatacctgcaaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sperm protein associated with the nucleus, X-linked, family member A1
- solute carrier family 37 (glycerol-3-phosphate transporter), member 3
- solute carrier family 4 (anion exchanger), member 1, adaptor protein
- translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)

Buy SPANXA1-sperm protein associated with the nucleus, X-linked, family member A1 Gene now

Add to cart