No products
Prices are tax excluded
PTXBC062990
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC062990 |
Product type: | DNA & cDNA |
Ncbi symbol: | SLC37A2 |
Origin species: | Human |
Product name: | SLC37A2-solute carrier family 37 (glycerol-3-phosphate transporter), member 2 Gene |
Size: | 2ug |
Accessions: | BC062990 |
Gene id: | 219855 |
Gene description: | solute carrier family 37 (glycerol-3-phosphate transporter), member 2 |
Synonyms: | glucose-6-phosphate exchanger SLC37A2; pp11662; solute carrier family 37 (glucose-6-phosphate transporter), member 2; solute carrier family 37 (glycerol-3-phosphate transporter), member 2; sugar phosphate exchanger 2; solute carrier family 37 member 2 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgttcctgtacaactacattggccaggacgggattgccagctccatagtgatgctgatcatctgtgggggcctggtcaatggcccatacgcgctcatcaccactgctgtctctgctgacctggggactcacaagagcctgaagggcaacgccaaagccctgtccacggtcacggccatcattgacggcaccggctccataggtgcggctctggggcctctgctggctgggctcatctcccccacgggctggaacaatgtcttctacatgctcatctctgccgacgtcctagcctgcttgctcctttgccggttagtatacaaagagatcttggcctggaaggtgtccctgagcagaggcagcgggtataaagaaatatga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - solute carrier family 37 (glycerol-3-phosphate transporter), member 2 - sperm protein associated with the nucleus, X-linked, family member A1 - sperm protein associated with the nucleus, X-linked, family member A1 - solute carrier family 37 (glycerol-3-phosphate transporter), member 3 |