Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CRADD-CASP2 and RIPK1 domain containing adaptor with death domain Gene
PTXBC037905
New product
Data sheet of CRADD-CASP2 and RIPK1 domain containing adaptor with death domain Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CRADD-CASP2 and RIPK1 domain containing adaptor with death domain Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC037905 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CRADD |
| Origin species: | Human |
| Product name: | CRADD-CASP2 and RIPK1 domain containing adaptor with death domain Gene |
| Size: | 2ug |
| Accessions: | BC037905 |
| Gene id: | 8738 |
| Gene description: | CASP2 and RIPK1 domain containing adaptor with death domain |
| Synonyms: | death domain containing protein CRADD; death domain-containing protein CRADD; MRT34; RAIDD; RIP-associated ICH1/CED3-homologous protein with death domain; caspase and RIP adaptor with death domain; death adaptor molecule RAIDD; CASP2 and RIPK1 domain containing adaptor with death domain |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggccagagacaaacaagtactccgctcacttcgcctggagctgggtgcagaggtattggtggagggactggttcttcagtacgtctacgaggaaggaatcttgacggaaaaccatattcaagaaatcaatgctcaaaccacaggcctccggaaaacaatgctcctgctggatatcctaccttccaggggccctaaagcatttgatacattcctagattccctacaggagtttccctgggtcagggagaagctgaagaaggcaagggaagaggccatgaccgacctgcctgcaggtgacagattgactgggatcccctcgcacatcctcaacagctccccatcagaccggcagattaaccagctggcccagaggctgggccctgagtgggagcccatggtgctgtctctgggactgtcccagacggatatctaccgctgtaaggccaaccacccccacaacgtgcagtcgcaggtggtggaggccttcatccgttggcggcagcgcttcgggaagcaggccaccttccagagcctgcacaacgggctgcgggctgtggaggtggacccctcgctgctcctgcacatgttggagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) - proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) - cysteine-rich secretory protein LCCL domain containing 2 - glycerophosphodiester phosphodiesterase domain containing 5 |