Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PRRG4-proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) Gene
PTXBC063393
New product
Data sheet of PRRG4-proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRRG4-proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063393 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRRG4 |
| Origin species: | Human |
| Product name: | PRRG4-proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) Gene |
| Size: | 2ug |
| Accessions: | BC063393 |
| Gene id: | 79056 |
| Gene description: | proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) |
| Synonyms: | PRGP4; TMG4; transmembrane gamma-carboxyglutamic acid protein 4; proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane); proline rich Gla 4 (transmembrane) isoform 1; proline rich Gla 4 (transmembrane) isoform 2; proline rich Gla 4 (transmembrane) isoform 3; proline-rich Gla protein 4; proline-rich gamma-carboxyglutamic acid protein 4; proline rich and Gla domain 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttacgcttctggttctactcagccaactgcccacagttaccctggggtttcctcattgcgcaagaggtccaaaggcttctaagcatgcgggagaagaagtgtttacatcaaaagaagaagcaaactttttcatacatagacgccttctgtataatagatttgatctggagctcttcactcccggcaacctagaaagagagtgcaatgaagaactttgcaattatgaggaagccagagagatttttgtggatgaagataaaacgattgcattttggcaggaatattcagctaaaggaccaaccacaaaatcagatggcaacagagagaaaatagatgttatgggccttctgactggattaattgctgctggagtatttttggttatttttggattacttggctactatctttgtatcactaagtgtaataggctacaacatccatgctcttcagccgtctatgaaagggggaggcacactccctccatcattttcagaagacctgaggaggctgccttgtctccattgccgccttctgtggaggatgcaggattaccttcttatgaacaggcagtggcgctgaccagaaaacacagtgtttcaccaccaccaccatatcctgggcacacaaaaggatttagggtatttaaaaaatctatgtctctcccatctcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cysteine-rich secretory protein LCCL domain containing 2 - glycerophosphodiester phosphodiesterase domain containing 5 - ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast) - ADAM metallopeptidase with thrombospondin type 1 motif, 4 |