GDPD5-glycerophosphodiester phosphodiesterase domain containing 5 Gene View larger

GDPD5-glycerophosphodiester phosphodiesterase domain containing 5 Gene

PTXBC018771

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GDPD5-glycerophosphodiester phosphodiesterase domain containing 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GDPD5-glycerophosphodiester phosphodiesterase domain containing 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018771
Product type: DNA & cDNA
Ncbi symbol: GDPD5
Origin species: Human
Product name: GDPD5-glycerophosphodiester phosphodiesterase domain containing 5 Gene
Size: 2ug
Accessions: BC018771
Gene id: 81544
Gene description: glycerophosphodiester phosphodiesterase domain containing 5
Synonyms: GDE2; PP1665; glycerophosphodiester phosphodiesterase domain-containing protein 5; glycerophosphodiester phosphodiesterase 2; glycerophosphodiester phosphodiesterase domain containing 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaagaaagacctcggccccaagcctgctctcattggccaccgcggggcccccatgctggctccagagcacacgctcatgtccttccggaaggccctcgagcagaagctgtacgggctccaggctgacattaccatcagcctggacggcgtgcccttcctcatgcatgacaccaccctgcggcgcaccaccaacgtggaggaggagttcccggagctggcccgcaggcctgcctccatgcttaactggaccaccctgcagagactcaacgctggccagtggttcctgaagactgaccccttctggacagccagctccctgtcaccctccgaccacagagaggcccagaaccagtccatctgcagcctggcagagctcctggagctggccaagggcaatgccacactgctgctcaacctgcgtgacccgccccgggagcacccctaccgcagcagttttatcaacgtgactctggaggccgtgctgcactccggcttcccccagcaccaggtcatgtggctgcctagcaggcagaggcccctggtgcggaaggtggctcccggcttccaacagacatcaggctccaaggaggcagtcgccagcctgcggagaggccacatccagcggctgaacctgcgctacactcaggtgtcccgccaggagctcagggactacgcgtcctggaacctgagtgtgaacctctacacagtcaacgcaccgtggctcttctccctgctgtggtgtgcgggggtcccatccgtcacctctgacaactcccacaccctgtcccaggtgccttcccccctctggatcatgcccccggacgagtactgtctcatgtgggtcactgccgacctggtctccttcaccctcatcgtgggcatcttcgtgctccagaagtggcgcctgggtggcatacggagctacaaccctgagcagatcatgctgagtgctgcggtgcgccggaccagccgggacgtcagcatcatgaaggagaagcttattttctcagagatcagcgatggtgtagaggtctccgatgtgctctccgtatgttcagacaacagttatgacacatatgccaacagcaccgccacccctgtgggcccccgagggggtggcagccacaccaagaccctcatagagcggagtgggcgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast)
- ADAM metallopeptidase with thrombospondin type 1 motif, 4
- carcinoembryonic antigen-related cell adhesion molecule 8
- nudix (nucleoside diphosphate linked moiety X)-type motif 1

Buy GDPD5-glycerophosphodiester phosphodiesterase domain containing 5 Gene now

Add to cart