Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CEACAM8-carcinoembryonic antigen-related cell adhesion molecule 8 Gene
PTXBC026263
New product
Data sheet of CEACAM8-carcinoembryonic antigen-related cell adhesion molecule 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CEACAM8-carcinoembryonic antigen-related cell adhesion molecule 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026263 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CEACAM8 |
| Origin species: | Human |
| Product name: | CEACAM8-carcinoembryonic antigen-related cell adhesion molecule 8 Gene |
| Size: | 2ug |
| Accessions: | BC026263 |
| Gene id: | 1088 |
| Gene description: | carcinoembryonic antigen-related cell adhesion molecule 8 |
| Synonyms: | CD66b; CD67; CGM6; NCA-95; carcinoembryonic antigen-related cell adhesion molecule 8; CD67 antigen; carcinoembryonic antigen CGM6; carcinoembryonic antigen gene family member 6; non-specific cross-reacting antigen NCA-95; carcinoembryonic antigen related cell adhesion molecule 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggcccatctcagccccttcctgcagatggcgcatcccctggcaggggctcctgctcacagcctcacttttcaccttctggaacccgcccaccactgctcagctcactattgaagctgtgccatccaatgctgcagaggggaaggaggttcttctacttgtccacaatctgccccaggaccctcgtggctacaactggtacaaaggggaaacagtggatgccaaccgtcgaattataggatatgtaatatcaaatcaacagattaccccagggcctgcatacagcaatcgagagacaatataccccaatgcatccctgctgatgcggaacgtcaccagaaatgacacaggatcctacaccctacaagtcataaagctaaatcttatgagtgaagaagtaactggccagttcagcgtacatccggagactcccaagccctccatctccagcaacaactccaaccccgtggaggacaaggatgctgtggccttcacctgtgaacctgagactcagaacacaacctacctgtggtgggtaaatggtcagagtctcccggtcagtcccaggctgcagctgtccaatggcaacaggaccctcactctactcagtgtcacaaggaatgacgtaggaccctatgaatgtgaaatacagaacccagcgagtgcaaacttcagtgacccagtcaccctgaatgtcctctatggcccagatgcccccaccatttccccttcagacacctattaccatgcaggggtaaatctcaacctctcctgccatgcggcctctaatccaccctcacagtattcttggtctgtcaatggcacattccagcaatacacacaaaagctctttatccccaacatcactacaaagaacagcggatcctatgcctgccacaccactaactcagccactggccgcaacaggaccacagtcaggatgatcacagtctctgatgctttagtacaaggaagttctcctggcctctcagctagagccactgtcagcatcatgattggagtactggccagggtggctctgatatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nudix (nucleoside diphosphate linked moiety X)-type motif 1 - nudix (nucleoside diphosphate linked moiety X)-type motif 4 - alveolar soft part sarcoma chromosome region, candidate 1 - mitogen-activated protein kinase 8 interacting protein 2 |