Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MAPK8IP2-mitogen-activated protein kinase 8 interacting protein 2 Gene
PTXBC009940
New product
Data sheet of MAPK8IP2-mitogen-activated protein kinase 8 interacting protein 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAPK8IP2-mitogen-activated protein kinase 8 interacting protein 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009940 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAPK8IP2 |
| Origin species: | Human |
| Product name: | MAPK8IP2-mitogen-activated protein kinase 8 interacting protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC009940 |
| Gene id: | 23542 |
| Gene description: | mitogen-activated protein kinase 8 interacting protein 2 |
| Synonyms: | IB-2; IB2; JIP2; PRKM8IPL; C-Jun-amino-terminal kinase-interacting protein 2; JNK MAP kinase scaffold protein 2; JNK MAP kinase scaffold protein JIP2; JNK-interacting protein 2; homologous to mouse JIP-1; islet-brain 2; mitogen-activated protein kinase 8 interacting protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggatcgcgcggagatgttttctctctccaccttccactcgctgtcgccgccgggctgcaggcctccccaggacataagcctggaagaatttgacgacgaagatctgtctgagatcactgatgactgtggcctgggcctcagctacgactcagaccactgtgagaaggacagcctctccctggggcgctcggagcagccgcaccccatctgctccttccaggatgacttccaggagtttgagatgatcgatgacaatgaagaggaggacgaagaggacgacgaggaagaggaggatgccgaggacagtgcggggtcccccgggggcaggggcacgggcccctcggcgccgcgggacgcgtcgctggtgtacgacgcggtcaagtacacgctggtggtggatgagcacacgcagctggagctggtgagcctgcggcgctgtgctgggctgggccacgacagcgaagaggacagcggcggggaggccagcgaggaggaggcgggcgcggcgctgctaggcggcggtcaggtctcgggggacacctcgccggacagccctgacctcactttctccaagaagttcctcaatgtcttcgtcaacagcacatctcggtcctccagcaccgagtcctttggccttttctcctgtctggtcaacggcgaggagcgagagcagactcaccgggctgtgttcaggttcatcccgcggcatccagacgagctggagctggatgtggatgaccctgtgttggtggaggccgaggaggacgacttctggttccgtggcttcaacatgcgcacgggggagcgcggtgtgtttcctgccttctacgcccatgcggtgcccggccctgccaaggacctgctggggagtaagcggagcccctgctgggtggagcgctttgacgtgcagttcctgggctccgtggaggtgccctgccaccagggcaacggcatcctgtgtgcagccatgcagaagattgccactgcccggaaactgaccgtccacctgcgccctcctgcctcctgtgacctcgagatctctcttcggggggtcaagctgagtctgagcggaggagggcccgagttccagcgctgcagccatttcttccagatgaagaacatctccttctgcggctgccatccccgcaacagctgctatttcggcttcatcaccaaacaccccctgctgagccgcttcgcctgccacgtctttgtctcccaggagtccatgaggccggtggcgcagagtgtgggccgcgccttcctggagtactaccaagagcacctggcgtacgcctgccccacggaggacatctacctggagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sprouty homolog 1, antagonist of FGF signaling (Drosophila) - protein kinase, cAMP-dependent, regulatory, type II, beta - LanC lantibiotic synthetase component C-like 2 (bacterial) - eukaryotic translation initiation factor 2 alpha kinase 4 |