Login to display prices
Login to display prices
MAPK8IP2-mitogen-activated protein kinase 8 interacting protein 2 Gene View larger

MAPK8IP2-mitogen-activated protein kinase 8 interacting protein 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAPK8IP2-mitogen-activated protein kinase 8 interacting protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAPK8IP2-mitogen-activated protein kinase 8 interacting protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009940
Product type: DNA & cDNA
Ncbi symbol: MAPK8IP2
Origin species: Human
Product name: MAPK8IP2-mitogen-activated protein kinase 8 interacting protein 2 Gene
Size: 2ug
Accessions: BC009940
Gene id: 23542
Gene description: mitogen-activated protein kinase 8 interacting protein 2
Synonyms: IB-2; IB2; JIP2; PRKM8IPL; C-Jun-amino-terminal kinase-interacting protein 2; JNK MAP kinase scaffold protein 2; JNK MAP kinase scaffold protein JIP2; JNK-interacting protein 2; homologous to mouse JIP-1; islet-brain 2; mitogen-activated protein kinase 8 interacting protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggatcgcgcggagatgttttctctctccaccttccactcgctgtcgccgccgggctgcaggcctccccaggacataagcctggaagaatttgacgacgaagatctgtctgagatcactgatgactgtggcctgggcctcagctacgactcagaccactgtgagaaggacagcctctccctggggcgctcggagcagccgcaccccatctgctccttccaggatgacttccaggagtttgagatgatcgatgacaatgaagaggaggacgaagaggacgacgaggaagaggaggatgccgaggacagtgcggggtcccccgggggcaggggcacgggcccctcggcgccgcgggacgcgtcgctggtgtacgacgcggtcaagtacacgctggtggtggatgagcacacgcagctggagctggtgagcctgcggcgctgtgctgggctgggccacgacagcgaagaggacagcggcggggaggccagcgaggaggaggcgggcgcggcgctgctaggcggcggtcaggtctcgggggacacctcgccggacagccctgacctcactttctccaagaagttcctcaatgtcttcgtcaacagcacatctcggtcctccagcaccgagtcctttggccttttctcctgtctggtcaacggcgaggagcgagagcagactcaccgggctgtgttcaggttcatcccgcggcatccagacgagctggagctggatgtggatgaccctgtgttggtggaggccgaggaggacgacttctggttccgtggcttcaacatgcgcacgggggagcgcggtgtgtttcctgccttctacgcccatgcggtgcccggccctgccaaggacctgctggggagtaagcggagcccctgctgggtggagcgctttgacgtgcagttcctgggctccgtggaggtgccctgccaccagggcaacggcatcctgtgtgcagccatgcagaagattgccactgcccggaaactgaccgtccacctgcgccctcctgcctcctgtgacctcgagatctctcttcggggggtcaagctgagtctgagcggaggagggcccgagttccagcgctgcagccatttcttccagatgaagaacatctccttctgcggctgccatccccgcaacagctgctatttcggcttcatcaccaaacaccccctgctgagccgcttcgcctgccacgtctttgtctcccaggagtccatgaggccggtggcgcagagtgtgggccgcgccttcctggagtactaccaagagcacctggcgtacgcctgccccacggaggacatctacctggagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sprouty homolog 1, antagonist of FGF signaling (Drosophila)
- protein kinase, cAMP-dependent, regulatory, type II, beta
- LanC lantibiotic synthetase component C-like 2 (bacterial)
- eukaryotic translation initiation factor 2 alpha kinase 4