Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PRKAR2B-protein kinase, cAMP-dependent, regulatory, type II, beta Gene
PTXBC075800
New product
Data sheet of PRKAR2B-protein kinase, cAMP-dependent, regulatory, type II, beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRKAR2B-protein kinase, cAMP-dependent, regulatory, type II, beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC075800 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRKAR2B |
| Origin species: | Human |
| Product name: | PRKAR2B-protein kinase, cAMP-dependent, regulatory, type II, beta Gene |
| Size: | 2ug |
| Accessions: | BC075800 |
| Gene id: | 5577 |
| Gene description: | protein kinase, cAMP-dependent, regulatory, type II, beta |
| Synonyms: | PRKAR2; RII-BETA; cAMP-dependent protein kinase type II-beta regulatory subunit; H_RG363E19.2; WUGSC:H_RG363E19.2; cAMP-dependent protein kinase type II-beta regulatory chain; protein kinase, cAMP-dependent, regulatory subunit type II beta; protein kinase, cAMP-dependent, regulatory, type II, beta; protein kinase cAMP-dependent type II regulatory subunit beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcatcgagatcccggcgggactgacggagctgctgcagggcttcacggtggaggtgctgaggcaccagcccgcggacctgctggagttcgctctgcagcacttcacccgcctgcagcaggagaacgagcgcaaaggcaccgcgcgcttctgccatgagggcaggacctggggggacctgggcgccgctgccgggggcggcacccccagcaagggggtcaacttcgccgaggagcccatgcagtccgactccgaggacggggaggaggaggaggcggcgcccgcggacgcaggggcgttcaatgctccagtaataaaccgattcacaaggcgtgcctcagtatgtgcagaagcttataatcctgatgaagaagaagatgatgcagagtccaggattatacatccaaaaactgatgatcaaagaaataggttgcaagaggcttgcaaagacatcctgctgtttaagaatctggatccggagcagatgtctcaagtattagatgccatgtttgaaaaattggtcaaagatggggagcatgtaattgatcaaggtgacgatggtgacaacttttatgtaattgatagaggcacatttgatatttatgtgaaatgtgatggtgttggaagatgtgttggtaactatgataatcgtgggagtttcggcgaactggccttaatgtacaatacacccagagcagctacaatcactgctacctctcctggtgctctgtggggtttggacagggtaaccttcaggagaataattgtgaaaaacaatgccaaaaagagaaaaatgtatgaaagctttattgagtcactgccattccttaaatctttggagttttctgaacgcctgaaagtagtagatgtgataggcaccaaagtatacaacgatggagaacaaatcattgctcagggagattcggctgattcttttttcattgtagaatctggagaagtgaaaattactatgaaaagaaagggtaaatcagaagtggaagagaatggtgcagtagaaatcgctcgatgctcgcggggacagtactttggagagcttgccctggtaactaacaaacctcgagcagcttctgcccacgccattgggactgtcaaatgtttagcaatggatgtgcaagcatttgaaaggcttctgggaccttgcatggaaattatgaaaaggaacatcgctacctatgaagaacagttagttgccctgtttggaacgaacatggatattgttgaacccactgcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - LanC lantibiotic synthetase component C-like 2 (bacterial) - eukaryotic translation initiation factor 2 alpha kinase 4 - protein kinase C and casein kinase substrate in neurons 3 - high-mobility group (nonhistone chromosomal) protein 4-like |