Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HMG4L-high-mobility group (nonhistone chromosomal) protein 4-like Gene
PTXBC103851
New product
Data sheet of HMG4L-high-mobility group (nonhistone chromosomal) protein 4-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HMG4L-high-mobility group (nonhistone chromosomal) protein 4-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC103851 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HMG4L |
| Origin species: | Human |
| Product name: | HMG4L-high-mobility group (nonhistone chromosomal) protein 4-like Gene |
| Size: | 2ug |
| Accessions: | BC103851 |
| Gene id: | 128872 |
| Gene description: | high-mobility group (nonhistone chromosomal) protein 4-like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaaaggcggataaggtgcactgtgatagagaaatgaaggattatggaccagctaagggaggcaagaacgatcctaatgcccccaaaaggccactgtctggattcttcctgttctgttcagaattctgccccaagatcaaatccacaaaccctggcatctctattggagacgtggcaaaaaagctgggtgagatgtggaataacttaaatgacagtgaaaagcagccttatgtcactaaggtggcaaagctgaagaagtatgagaaggatgttgctgactataagtcgaaaggaaagttggacggcacaaaaggtcctgctaaagttgcctgggaaaagatggaagaagaagatgaagaagatggggaggaagagaaggaggatgaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 5-hydroxytryptamine (serotonin) receptor 3, family member E - carcinoembryonic antigen-related cell adhesion molecule 3 - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa - carcinoembryonic antigen-related cell adhesion molecule 7 |