Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HTR3E-5-hydroxytryptamine (serotonin) receptor 3, family member E Gene
PTXBC101185
New product
Data sheet of HTR3E-5-hydroxytryptamine (serotonin) receptor 3, family member E Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HTR3E-5-hydroxytryptamine (serotonin) receptor 3, family member E Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC101185 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HTR3E |
| Origin species: | Human |
| Product name: | HTR3E-5-hydroxytryptamine (serotonin) receptor 3, family member E Gene |
| Size: | 2ug |
| Accessions: | BC101185 |
| Gene id: | 285242 |
| Gene description: | 5-hydroxytryptamine (serotonin) receptor 3, family member E |
| Synonyms: | 5-HT3-E; 5-HT3E; 5-HT3c1; 5-hydroxytryptamine receptor 3E; 5-hydroxytryptamine (serotonin) receptor 3, family member E; 5-hydroxytryptamine (serotonin) receptor 3E, ionotropic; 5-hydroxytryptamine receptor 3 subunit E |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgccatcctagatgtgaatgaacagctgcacctcttgtcatcattcctgtggctggaaatggtttgggataacccatttatcagctggaacccagaggaatgtgagggcatcacgaagatgagtatggcagccaagaacctgtggctcccagacattttcatcattgaactcatggatgtggataagaccccaaaaggcctcacagcatatgtaagtaatgaaggtcgcatcaggtataagaaacccatgaaggtggacagtatctgtaacctggacatcttctacttccccttcgaccagcagaactgcacactcaccttcagctcattcctctacacagtggacagcatgttgctggacatggagaaagaagtgtgggaaataacagacgcatcccggaacatccttcagacccatggagaatgggagctcctgggcctcagcaaggccaccgcaaagttgtccagggtggccatcaggcgcaggcccagcctctatgtcataaaccttctcgtgcccagtggctttctggttgccatcgatgccctcagcttctacctgccagtgaaaagtgggaatcgtgtcccattcaagataacgctcctgctgggctacaacgtcttcctgctcatgatgagtgacttgctccccaccagtggcacccccctcatcggtgtctacttcgccctgtgcctgtccctgatggtgggcagcctgctggagaccatcttcatcacccacctgctgcacgtggccaccacccagcccccacccctgcctcggtggctccactccctgctgctccactgcaacagcccggggagatgctgtcccactgcgccccagaaggaaaataagggcccgggtctcacccccacccacctgcccggtgtgaaggagccagaggtatcagcagggcagatgccgggccctgcggaggcagagctgacagggggctcagaatggacaagggcccagcgggaacacgaggcccagaagcagcactcagtggagctgtggttgcagttcagccacgcgatggacgccatgctcttccgcctctacctgctcttcatggcctcctctatcatcaccgtcatatgcctctggaacacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - carcinoembryonic antigen-related cell adhesion molecule 3 - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa - carcinoembryonic antigen-related cell adhesion molecule 7 - small nuclear RNA activating complex, polypeptide 3, 50kDa |