Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SPRY1-sprouty homolog 1, antagonist of FGF signaling (Drosophila) Gene
PTXBC063856
New product
Data sheet of SPRY1-sprouty homolog 1, antagonist of FGF signaling (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPRY1-sprouty homolog 1, antagonist of FGF signaling (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063856 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPRY1 |
| Origin species: | Human |
| Product name: | SPRY1-sprouty homolog 1, antagonist of FGF signaling (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC063856 |
| Gene id: | 10252 |
| Gene description: | sprouty homolog 1, antagonist of FGF signaling (Drosophila) |
| Synonyms: | hSPRY1; protein sprouty homolog 1; sprouty homolog 1, antagonist of FGF signaling; sprouty, Drosophila, homolog of, 1 (antagonist of FGF signaling); spry-1; sprouty RTK signaling antagonist 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatccccaaaatcaacatggcagtggcagttcgttagttgtgatccagcagccttctttggatagccgtcagagattagactatgagagagagattcagcctactgctattttgtccttagaccagatcaaggccataagaggcagcaatgaatacacagaagggccttcggtggtgaaaagacctgctcctcggacagcaccaagacaagaaaagcatgaaaggactcatgaaatcataccaattaatgtgaataataactacgagcacagacacacaagccacctgggacatgcagtactcccaagtaatgccaggggccccattttgagcagatcaaccagcactggaagtgcagccagctctgggagcaacagcagtgcctcttctgaacagggactgttaggaaggtcaccaccaaccagaccagtccctggtcataggtctgaaagggcaatccggacccagcccaagcaactgattgtggatgacttgaagggttccttgaaagaggacctgacacagcacaagttcatttgtgaacagtgtgggaagtgcaagtgtggagaatgcactgctcccaggaccctaccatcctgtttggcctgtaaccggcagtgcctttgctctgctgagagcatggtggaatatggaacctgcatgtgcttagtcaagggcatcttctaccactgctccaatgacgacgaaggggattcctattcagataatccttgctcctgttcacaatcacactgctgctctagatacctgtgtatgggagccatgtctttatttttaccttgcttactctgttatcctcctgctaaaggatgcctgaagctgtgcaggaggtgttatgactggatccatcgcccagggtgcagatgtaagaactccaacactgtctattgtaagctggagagctgcccctcccggggtcagggtaaaccatcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein kinase, cAMP-dependent, regulatory, type II, beta - LanC lantibiotic synthetase component C-like 2 (bacterial) - eukaryotic translation initiation factor 2 alpha kinase 4 - protein kinase C and casein kinase substrate in neurons 3 |