Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UBE2D3-ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Gene
PTXBC066917
New product
Data sheet of UBE2D3-ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2D3-ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066917 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2D3 |
| Origin species: | Human |
| Product name: | UBE2D3-ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Gene |
| Size: | 2ug |
| Accessions: | BC066917 |
| Gene id: | 7323 |
| Gene description: | ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) |
| Synonyms: | E2(17)KB3; UBC4/5; UBCH5C; ubiquitin-conjugating enzyme E2 D3; (E3-independent) E2 ubiquitin-conjugating enzyme D3; E2 ubiquitin-conjugating enzyme D3; E2(17)KB 3; PRO2116; ubiquitin carrier protein D3; ubiquitin conjugating enzyme E2D 3; ubiquitin-conjugating enzyme E2(17)KB 3; ubiquitin-conjugating enzyme E2-17 kDa 3; ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast); ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5); ubiquitin-protein ligase D3; ubiquitin conjugating enzyme E2 D3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgctgaaacggattaataaggaacttagtgatttggcccgtgaccctccagcacaatgttctgcaggtccagttggggatgatatgtttcattggcaagccacaattatgggacctaatgacagcccatatcaaggcggtgtattctttttgacaattcattttcctacagactaccccttcaaaccacctaaggttgcatttacaacaagaatttatcatccaaatattaacagtaatggcagcatttgtctcgatattctaagatcacagtggtcgcctgctttaacaatttctaaagttcttttatccatttgttcactgctatgtgatccaaacccagatgaccccctggtgccagagcttgcacggatctataaaacagacagagataagtacaacagaatatctcgggaatggactcagaagtatgccatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) - cysteine-rich secretory protein LCCL domain containing 2 - glycerophosphodiester phosphodiesterase domain containing 5 - ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast) |