Login to display prices
Login to display prices
UBE2D3-ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Gene View larger

UBE2D3-ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2D3-ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2D3-ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC066917
Product type: DNA & cDNA
Ncbi symbol: UBE2D3
Origin species: Human
Product name: UBE2D3-ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) Gene
Size: 2ug
Accessions: BC066917
Gene id: 7323
Gene description: ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)
Synonyms: E2(17)KB3; UBC4/5; UBCH5C; ubiquitin-conjugating enzyme E2 D3; (E3-independent) E2 ubiquitin-conjugating enzyme D3; E2 ubiquitin-conjugating enzyme D3; E2(17)KB 3; PRO2116; ubiquitin carrier protein D3; ubiquitin conjugating enzyme E2D 3; ubiquitin-conjugating enzyme E2(17)KB 3; ubiquitin-conjugating enzyme E2-17 kDa 3; ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast); ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5); ubiquitin-protein ligase D3; ubiquitin conjugating enzyme E2 D3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctgaaacggattaataaggaacttagtgatttggcccgtgaccctccagcacaatgttctgcaggtccagttggggatgatatgtttcattggcaagccacaattatgggacctaatgacagcccatatcaaggcggtgtattctttttgacaattcattttcctacagactaccccttcaaaccacctaaggttgcatttacaacaagaatttatcatccaaatattaacagtaatggcagcatttgtctcgatattctaagatcacagtggtcgcctgctttaacaatttctaaagttcttttatccatttgttcactgctatgtgatccaaacccagatgaccccctggtgccagagcttgcacggatctataaaacagacagagataagtacaacagaatatctcgggaatggactcagaagtatgccatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)
- cysteine-rich secretory protein LCCL domain containing 2
- glycerophosphodiester phosphodiesterase domain containing 5
- ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast)