Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CMTM8-CKLF-like MARVEL transmembrane domain containing 8 Gene
PTXBC041390
New product
Data sheet of CMTM8-CKLF-like MARVEL transmembrane domain containing 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CMTM8-CKLF-like MARVEL transmembrane domain containing 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC041390 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CMTM8 |
| Origin species: | Human |
| Product name: | CMTM8-CKLF-like MARVEL transmembrane domain containing 8 Gene |
| Size: | 2ug |
| Accessions: | BC041390 |
| Gene id: | 152189 |
| Gene description: | CKLF-like MARVEL transmembrane domain containing 8 |
| Synonyms: | CKLFSF8-V2; CKLF-like MARVEL transmembrane domain-containing protein 8; chemokine-like factor superfamily member 8; CKLF like MARVEL transmembrane domain containing 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggagccgcagcgcgcccgctcgcacacagtcaccaccaccgccagctccttcgcagagaacttctccaccagcagcagcagcttcgcctacgaccgggagttcctccgcaccctgcacggcttcctcatcgtggccgagatcgttctggggctgctggtatggacgcttattgctggaactgagtacttccgggtcccagcatttggctgggtcatgtttgtagctgtatcttactgggtcctcaccgtcttcttcctcattatctacataacaatgacctacaccaggattccccaggtgccctggacaacagtgggcctgtgctttaacggcagtgccttcgtcttgtacctctctgccgctgttgtagatgcatcttccgtctcccctgagagggacagtcacaacttcaacagctgggcggcctcatcgttctttgccttcctggtcaccatctgctacgctggaaatacatatttcagttttatagcatggagatccaggaccatacagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ligand dependent nuclear receptor corepressor-like - SET domain containing (lysine methyltransferase) 8 - cAMP responsive element binding protein 3-like 4 - CKLF-like MARVEL transmembrane domain containing 3 |