Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LCORL-ligand dependent nuclear receptor corepressor-like Gene
PTXBC037322
New product
Data sheet of LCORL-ligand dependent nuclear receptor corepressor-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LCORL-ligand dependent nuclear receptor corepressor-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC037322 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LCORL |
| Origin species: | Human |
| Product name: | LCORL-ligand dependent nuclear receptor corepressor-like Gene |
| Size: | 2ug |
| Accessions: | BC037322 |
| Gene id: | 254251 |
| Gene description: | ligand dependent nuclear receptor corepressor-like |
| Synonyms: | MLR1; ligand-dependent nuclear receptor corepressor-like protein; LCOR-like protein; MBLK1-related protein; transcription factor MLR1; ligand dependent nuclear receptor corepressor like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacaagggaagagagagaatggccgctgccgccgccgctgctgccgccgccgccgccgccgctcagtgccggagccctcggtgcgcggcggagagaagaggattccggcgggaactcgactcttggcgccaccgcctcatgcactgtgtaggttttgagagtattttagaagggctttatggaccacggctacgaagagacctcagtttatttgaagactgtgaaccagaagagctgactgactggtctatggatgaaaaatgttcattttgtaacctacagagagaagcagtcagtgattgtataccatctcttgattcttcacagtcaacaccaacagaggagctatcatctcagggccagtccaacactgataagattgaatgccaagcagaaaattacctaaatgcactctttcgaaagaaagatcttcctcagaactgtgatcctaacattcccctagttgctcaggaattaatgaaaaagatgatacgtcaatttgcgattgagtacatttcaaaaagtggtaaaactcaagagaatagaaatggttcaattggaccaagtatagtatgtaaaagtatccaaatgaatcaagcagaaaactcccttcaggaagagcaggaaggccccttagacctcactgtgaatcgaatgcaagaacaaaatactcagcaaggggatggagtgttagatctctctacaaagaaaaccagcataaaatctgaagagtcatccatatgtgatccttcttctgaaaattcagtggctggcatgctacaagtgaaaactgatgagaaactgaatgtgtctgatgagaatacagcaagttgccctttgagccccattaagatgtgccttaatcgtcccattgaatggaatctgaatttgacaacagcatctctaacgagctgtacagttcataaccaaaatctcaaaagcgaagagaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SET domain containing (lysine methyltransferase) 8 - cAMP responsive element binding protein 3-like 4 - CKLF-like MARVEL transmembrane domain containing 3 - sulfotransferase family, cytosolic, 1C, member 4 |