Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CMTM3-CKLF-like MARVEL transmembrane domain containing 3 Gene
PTXBC023591
New product
Data sheet of CMTM3-CKLF-like MARVEL transmembrane domain containing 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CMTM3-CKLF-like MARVEL transmembrane domain containing 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC023591 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CMTM3 |
| Origin species: | Human |
| Product name: | CMTM3-CKLF-like MARVEL transmembrane domain containing 3 Gene |
| Size: | 2ug |
| Accessions: | BC023591 |
| Gene id: | 123920 |
| Gene description: | CKLF-like MARVEL transmembrane domain containing 3 |
| Synonyms: | BNAS2; CKLFSF3; CKLF-like MARVEL transmembrane domain-containing protein 3; chemokine-like factor superfamily member 3; CKLF like MARVEL transmembrane domain containing 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggcccccagaccccgaccccgacccggaccccgagcctgccggcggctcccgtcccggccccgcggtccccgggctccgcgccctgctgccggcgcgggctttcctctgctctctcaaaggccgcctcctgctggccgagtcgggtctctcattcatcacttttatctgctatgtggcgtcctcagcatctgccttcctcacagcgcctctgctggagttcctgctggccttgtacttcctctttgctgatgccatgcagctgaatgacaagtggcagggcttgtgctggcccatgatggacttcctgcgctgtgtcaccgcggccctcatctactttgctatctccatcacggccatcgccaagtactcggatggggcttccaaagccgctggggtgtttggcttctttgctaccatcgtgtttgcaactgatttctacctgatctttaacgacgtggccaaattcctcaaacaaggggactctgcagatgagaccacagcccacaagacagaagaagagaattccgactcggactctgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sulfotransferase family, cytosolic, 1C, member 4 - phosphatidylinositol-4-phosphate 5-kinase-like 1 - gamma-aminobutyric acid (GABA) A receptor, epsilon - activating signal cointegrator 1 complex subunit 3 |