Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PIP5KL1-phosphatidylinositol-4-phosphate 5-kinase-like 1 Gene
PTXBC042184
New product
Data sheet of PIP5KL1-phosphatidylinositol-4-phosphate 5-kinase-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PIP5KL1-phosphatidylinositol-4-phosphate 5-kinase-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC042184 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PIP5KL1 |
| Origin species: | Human |
| Product name: | PIP5KL1-phosphatidylinositol-4-phosphate 5-kinase-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC042184 |
| Gene id: | 138429 |
| Gene description: | phosphatidylinositol-4-phosphate 5-kinase-like 1 |
| Synonyms: | PIPKH; bA203J24.5; phosphatidylinositol 4-phosphate 5-kinase-like protein 1; PI(4)P 5-kinase-like protein 1; phosphatidylinositol phosphate kinase homolog; ptdIns(4)P-5-kinase-like protein 1; phosphatidylinositol-4-phosphate 5-kinase like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagagcgtcttctaccccgccggccgcatctccgagaggtatgacatcaaaggctgcgaggtgagccgctgggtggatcccgcccctgagggcagcccccttgttctggtgctgaaggacctcaactttcagggcaagaccatcaacctggggccccagcggagctggttcctccgccagatggaactggataccaccttcctccgggagctcaacgtgctggattacagcctcctgatagccttccaacgtctccacgaggatgagaggggcccgggcagcagcctcatcttccgcacggccaggtctgtgcaaggggcacagagcccggaagagtcgagagcccaaaaccgccggctgctgcccgacgcccccaacgccctacacatcctggacgggcccgagcagcgctatttcctgggcgtcgtggatctcgccacagtctacgggctccgcaagcggctggagcacctgtggaagacactgcgctacccaggccggaccttctccactgtcagcccggctcgctacgcccgtcgcctctgccagtgggtggaggcgcacacggagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gamma-aminobutyric acid (GABA) A receptor, epsilon - activating signal cointegrator 1 complex subunit 3 - radial spoke head 10 homolog B2 (Chlamydomonas) - doublesex and mab-3 related transcription factor 1 |