Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ASCC3-activating signal cointegrator 1 complex subunit 3 Gene
PTXBC050681
New product
Data sheet of ASCC3-activating signal cointegrator 1 complex subunit 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ASCC3-activating signal cointegrator 1 complex subunit 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC050681 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ASCC3 |
| Origin species: | Human |
| Product name: | ASCC3-activating signal cointegrator 1 complex subunit 3 Gene |
| Size: | 2ug |
| Accessions: | BC050681 |
| Gene id: | 10973 |
| Gene description: | activating signal cointegrator 1 complex subunit 3 |
| Synonyms: | ASC1p200; HELIC1; RNAH; activating signal cointegrator 1 complex subunit 3; ASC-1 complex subunit P200; RNA helicase family; helicase, ATP binding 1; trip4 complex subunit p200 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctttacctcgtctcacaggagccttgcgttccttttcaaatgtcaccaagcaagataattataatgaagaagtggctgacttaaagataaagcgatctaaacttcatgaacaagttttagatttgggcctgacatggaagaagataataaaatttttgaatgaaaaactggagaagagtaaaatgcaaagtataaatgaagacttaaaagatatattacatgctgcaaagcagatagaagtgaattgtccattccagaagaggaggctggatggaaaagaggaggatgagaagatgagcagagcttctgacagattcagaggactaagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - radial spoke head 10 homolog B2 (Chlamydomonas) - doublesex and mab-3 related transcription factor 1 - basal cell adhesion molecule (Lutheran blood group) - adaptor-related protein complex 1, gamma 2 subunit |