Login to display prices
Login to display prices
RSPH10B2-radial spoke head 10 homolog B2 (Chlamydomonas) Gene View larger

RSPH10B2-radial spoke head 10 homolog B2 (Chlamydomonas) Gene

PTXBC044242

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RSPH10B2-radial spoke head 10 homolog B2 (Chlamydomonas) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RSPH10B2-radial spoke head 10 homolog B2 (Chlamydomonas) Gene

Proteogenix catalog: PTXBC044242
Ncbi symbol: RSPH10B2
Product name: RSPH10B2-radial spoke head 10 homolog B2 (Chlamydomonas) Gene
Size: 2ug
Accessions: BC044242
Gene id: 728194
Gene description: radial spoke head 10 homolog B2 (Chlamydomonas)
Synonyms: radial spoke head 10 homolog B2; radial spoke head 10 homolog B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgccacggggaggggaggatgaggtggctgaccaccaacgaagagtacaccgggcggtgggagaggggcatccagaatggctttggaacacacacatggtttctaaagagaatccgcagttcccagtatcctttgagaaatgaatacataggggagtttgtaaatggatatcgtcacggacgtggcaagttttattatgccagtggagccatgtatgatggagaatgggtttccaataagaaacatggcatgggccgattaactttcaagaacgggcgtgtgtacgaaggcgcattctccaatgaccacatagctgggtttccggatcttgaagttgaattcatcagctgcctggacctgtcttcaggagttgccccaagactgtccaggagcgccgaactgatcagaaagcttgatggcagtgaaagtcattctgtgttgggatcgagcattgagctggatctaaatttgctcctggacatgtaccctgagacagtccaacctgaagaaaagaagcaggtggaatatgccgtcttaagaaatattacagaattaagaagaatttacagcttttacagcagcctgggatgcggccactctctggataatacctttctgatgacaaagcttcacttctggagatttctaaaagattgcaaatttcatcaccacaaactaactcttgctgatatggacaggatattaagtgccaataatgacataccagttgaagaaatccattctccatttacaacaatacttttgagaacatttttgaattacctcctgcatttggcgtaccacatttatcatgaagaattccagcaatttattccgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: