RSPH10B2-radial spoke head 10 homolog B2 (Chlamydomonas) Gene View larger

RSPH10B2-radial spoke head 10 homolog B2 (Chlamydomonas) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RSPH10B2-radial spoke head 10 homolog B2 (Chlamydomonas) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RSPH10B2-radial spoke head 10 homolog B2 (Chlamydomonas) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC044242
Product type: DNA & cDNA
Ncbi symbol: RSPH10B2
Origin species: Human
Product name: RSPH10B2-radial spoke head 10 homolog B2 (Chlamydomonas) Gene
Size: 2ug
Accessions: BC044242
Gene id: 728194
Gene description: radial spoke head 10 homolog B2 (Chlamydomonas)
Synonyms: radial spoke head 10 homolog B2; radial spoke head 10 homolog B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgccacggggaggggaggatgaggtggctgaccaccaacgaagagtacaccgggcggtgggagaggggcatccagaatggctttggaacacacacatggtttctaaagagaatccgcagttcccagtatcctttgagaaatgaatacataggggagtttgtaaatggatatcgtcacggacgtggcaagttttattatgccagtggagccatgtatgatggagaatgggtttccaataagaaacatggcatgggccgattaactttcaagaacgggcgtgtgtacgaaggcgcattctccaatgaccacatagctgggtttccggatcttgaagttgaattcatcagctgcctggacctgtcttcaggagttgccccaagactgtccaggagcgccgaactgatcagaaagcttgatggcagtgaaagtcattctgtgttgggatcgagcattgagctggatctaaatttgctcctggacatgtaccctgagacagtccaacctgaagaaaagaagcaggtggaatatgccgtcttaagaaatattacagaattaagaagaatttacagcttttacagcagcctgggatgcggccactctctggataatacctttctgatgacaaagcttcacttctggagatttctaaaagattgcaaatttcatcaccacaaactaactcttgctgatatggacaggatattaagtgccaataatgacataccagttgaagaaatccattctccatttacaacaatacttttgagaacatttttgaattacctcctgcatttggcgtaccacatttatcatgaagaattccagcaatttattccgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - doublesex and mab-3 related transcription factor 1
- basal cell adhesion molecule (Lutheran blood group)
- adaptor-related protein complex 1, gamma 2 subunit
- origin recognition complex, subunit 6 like (yeast)

Buy RSPH10B2-radial spoke head 10 homolog B2 (Chlamydomonas) Gene now

Add to cart