Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 973,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 973,00 €
View larger 
RSPH10B2-radial spoke head 10 homolog B2 (Chlamydomonas) Gene
PTXBC044242
New product
Data sheet of RSPH10B2-radial spoke head 10 homolog B2 (Chlamydomonas) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RSPH10B2-radial spoke head 10 homolog B2 (Chlamydomonas) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC044242 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RSPH10B2 |
| Origin species: | Human |
| Product name: | RSPH10B2-radial spoke head 10 homolog B2 (Chlamydomonas) Gene |
| Size: | 2ug |
| Accessions: | BC044242 |
| Gene id: | 728194 |
| Gene description: | radial spoke head 10 homolog B2 (Chlamydomonas) |
| Synonyms: | radial spoke head 10 homolog B2; radial spoke head 10 homolog B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgccacggggaggggaggatgaggtggctgaccaccaacgaagagtacaccgggcggtgggagaggggcatccagaatggctttggaacacacacatggtttctaaagagaatccgcagttcccagtatcctttgagaaatgaatacataggggagtttgtaaatggatatcgtcacggacgtggcaagttttattatgccagtggagccatgtatgatggagaatgggtttccaataagaaacatggcatgggccgattaactttcaagaacgggcgtgtgtacgaaggcgcattctccaatgaccacatagctgggtttccggatcttgaagttgaattcatcagctgcctggacctgtcttcaggagttgccccaagactgtccaggagcgccgaactgatcagaaagcttgatggcagtgaaagtcattctgtgttgggatcgagcattgagctggatctaaatttgctcctggacatgtaccctgagacagtccaacctgaagaaaagaagcaggtggaatatgccgtcttaagaaatattacagaattaagaagaatttacagcttttacagcagcctgggatgcggccactctctggataatacctttctgatgacaaagcttcacttctggagatttctaaaagattgcaaatttcatcaccacaaactaactcttgctgatatggacaggatattaagtgccaataatgacataccagttgaagaaatccattctccatttacaacaatacttttgagaacatttttgaattacctcctgcatttggcgtaccacatttatcatgaagaattccagcaatttattccgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - doublesex and mab-3 related transcription factor 1 - basal cell adhesion molecule (Lutheran blood group) - adaptor-related protein complex 1, gamma 2 subunit - origin recognition complex, subunit 6 like (yeast) |