Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ORC6L-origin recognition complex, subunit 6 like (yeast) Gene
PTXBC063565
New product
Data sheet of ORC6L-origin recognition complex, subunit 6 like (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ORC6L-origin recognition complex, subunit 6 like (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063565 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ORC6L |
| Origin species: | Human |
| Product name: | ORC6L-origin recognition complex, subunit 6 like (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC063565 |
| Gene id: | 23594 |
| Gene description: | origin recognition complex, subunit 6 like (yeast) |
| Synonyms: | ORC6L; origin recognition complex subunit 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggtcggagctgatcgggcgcctagccccgcgcctgggcctcgccgagcccgacatgctgaggaaagcagaggagtacttgcgcctgtcccgggtgaagtgtgtcggcctctccgcacgcaccacggagaccagcagtgcagtcatgtgcctggaccttgcagcttcctggatgaagtgccccttggacagggcttatttaattaaactttctggtttgaacaaggagacatatcagagctgtcttaaatcttttgagtgtttactgggcctgaattcaaatattggaataagagacctagctgtacagtttagctgtatagaagcagtgaacatggcttcaaagatactaaaaagctatgagtccagtcttccccagacacagcaagtggatcttgacttatccaggccacttttcacttctgctgcactgctttcagcatgcaagattctaaagctgaaagtggataaaaacaaaatggtagccacatccggtgtaaaaaaagctatatttgatcgactgtgtaaacaactagagaagattggacagcaggtcgacagagaacctggagatgtagctactccaccacggaagagaaagaagatagtggttgaagccccagcaaaggaaatggagaaggtagaggagatgccacataaaccacagaaagatgaagatctgacacaggattatgaagaatggaaaagaaaaattttggaaaatgctgccagtgctcaaaaggctacagcagagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cAMP responsive element binding protein 3-like 2 - E74-like factor 2 (ets domain transcription factor) - ATG9 autophagy related 9 homolog A (S. cerevisiae) - CKLF-like MARVEL transmembrane domain containing 2 |