Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CREB3L2-cAMP responsive element binding protein 3-like 2 Gene
PTXBC063666
New product
Data sheet of CREB3L2-cAMP responsive element binding protein 3-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CREB3L2-cAMP responsive element binding protein 3-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063666 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CREB3L2 |
| Origin species: | Human |
| Product name: | CREB3L2-cAMP responsive element binding protein 3-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC063666 |
| Gene id: | 64764 |
| Gene description: | cAMP responsive element binding protein 3-like 2 |
| Synonyms: | cyclic AMP-responsive element-binding protein 3-like protein 2; B-ZIB transcription factor; BBF2 human homolog on chromosome 7; FUS/BBF2H7 protein; TCAG_1951439; basic transcription factor 2; cAMP-responsive element-binding protein 3-like protein 2; cAMP responsive element binding protein 3 like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggtgctggagagcggggagcagggcgtgctgcagtgggaccgcaagctgagcgagctgtcagagcccggggacggcgaggccctcatgtaccacacgcacttctcagaacttctggatgagttttcccagaacgtcttgggtcagctcctgaatgatcctttcctctcagagaagagtgtgtcaatggaggtggaaccttccccgacgtccccggcgcctctcatccaggctgagcacagctactccctgtgcgaggagcctcgggcccagtcgcccttcacccacattaccagtgacagcttcaatgacgatgaggtggaaagtgagaaatggtacctgtctacagacttcccttcaacatccatcaagacagagccagttacagacgaaccacccccaggactcgttccgtctgtcactctgaccatcacagccatctccaccccgttggaaaaggaggaacctcctctggaaatgaacactggggttgattcctcgtgccagaccattattcctaaaattaagctggagcctcatgaagtggatcagtttctaaacttctctcctaaagaaggtctgtctgccctccctgtgtccctttgggttatggatatggtctctgggtctacagagagggaatatggcgagagagctgggatgagtttgtaccacagatgttgtagctggctttatgaaatagctctgttcttaaaaaataaaaattttgcttccaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - E74-like factor 2 (ets domain transcription factor) - ATG9 autophagy related 9 homolog A (S. cerevisiae) - CKLF-like MARVEL transmembrane domain containing 2 - meiotic nuclear divisions 1 homolog (S. cerevisiae) |