Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CREB3L4-cAMP responsive element binding protein 3-like 4 Gene
PTXBC038962
New product
Data sheet of CREB3L4-cAMP responsive element binding protein 3-like 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CREB3L4-cAMP responsive element binding protein 3-like 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC038962 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CREB3L4 |
| Origin species: | Human |
| Product name: | CREB3L4-cAMP responsive element binding protein 3-like 4 Gene |
| Size: | 2ug |
| Accessions: | BC038962 |
| Gene id: | 148327 |
| Gene description: | cAMP responsive element binding protein 3-like 4 |
| Synonyms: | AIBZIP; ATCE1; CREB3; JAL; hJAL; cyclic AMP-responsive element-binding protein 3-like protein 4; CREB-4; androgen-induced basic leucine zipper protein; attaching to CRE-like 1; cAMP responsive element binding protein 1; cAMP-responsive element-binding protein 3-like protein 4; cAMP-responsive element-binding protein 4; cyclic AMP-responsive element-binding protein 4; tisp40; transcript induced in spermiogenesis protein 40; cAMP responsive element binding protein 3 like 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatctcggaatccctgacctgctggacgcgtggctggagcccccagaggatatcttctcgacaggatccgtcctggagctgggactccactgcccccctccagaggttccggtaactaggctacaggaacagggactgcaaggctggaagtccggtggggaccgtggctgtggccttcaagagagtgagcctgaagatttcttgaagcttttcattgatcccaatgaggtgtactgctcagaagcatctcctggcagtgacagtggcatctctgaggacccctgccatccagacagtccccctgcccccagggcaaccagttctcctatgctctatgaggttgtctatgaggcaggggccctggagaggatgcagggggaaactgggccaaatgtaggccttatctccatccagctagatcagtggagcccagcatttatggtgcctgattcctgcatggtcagtgagctgccctttgatgctcatgcccacatcctgcccagagcaggcaccgtagccccagtgccctgtacaaccctgctgccctgtcaaaccctgttcctgaccgatgaggagaagcgtctgctggggcaggaaggggtttccctgccctctcacctgcccctcaccaaggcagaggagagggtcctcaagaaggtcaggaggaaaatccgtaacaagcagtcagctcaggacagtcggcggcggaagaaggagtacattgatgggctggagagcagggtggcagcctgttctgcacagaaccaagaattacagaaaaaagtccaggagctggagaggcacaacatctccttggtagctcagctccgccagctgcagacgctaattgctcaaacttccaacaaagctgcccagaccagcacttgtgttttgattcttcttttttccctggctctcatcatcctgcccagcttcagtccattccagagtcgaccagaagctgggtctgaggattaccagcctcacggagtgacttccagaaatatcctgacccacaaggacgtaacagaaaatctggagacccaagtggtagagtccagactgagggagccacctggagccaaggatgcaaatggctcaacaaggacactgcttgagaagatgggagggaagccaagacccagtgggcgcatccggtccgtgctgcatgcagatgagatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CKLF-like MARVEL transmembrane domain containing 3 - sulfotransferase family, cytosolic, 1C, member 4 - phosphatidylinositol-4-phosphate 5-kinase-like 1 - gamma-aminobutyric acid (GABA) A receptor, epsilon |