Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
OBFC2B-oligonucleotide/oligosaccharide-binding fold containing 2B Gene
PTXBC001079
New product
Data sheet of OBFC2B-oligonucleotide/oligosaccharide-binding fold containing 2B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OBFC2B-oligonucleotide/oligosaccharide-binding fold containing 2B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001079 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OBFC2B |
| Origin species: | Human |
| Product name: | OBFC2B-oligonucleotide/oligosaccharide-binding fold containing 2B Gene |
| Size: | 2ug |
| Accessions: | BC001079 |
| Gene id: | 79035 |
| Gene description: | oligonucleotide/oligosaccharide-binding fold containing 2B |
| Synonyms: | OBFC2B; SOSS-B1; SSB1; hSSB1; SOSS complex subunit B1; LP3587; oligonucleotide/oligosaccharide-binding fold containing 2B; oligonucleotide/oligosaccharide-binding fold-containing protein 2B; sensor of single-strand DNA complex subunit B1; sensor of ssDNA subunit B1; single strand DNA-binding protein 1; single-stranded DNA-binding protein 1; nucleic acid binding protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacgacggagacctttgtgaaggatatcaagcctgggctcaagaatctgaaccttatcttcattgtgctggagacaggccgagtgaccaagacaaaggacgggcatgaggttcggacctgcaaagtggcggacaaaacaggcagcatcaatatctctgtctgggacgatgttggcaatctgatccagcctggggacattatccggctcaccaaagggtacgcttcagttttcaaaggttgtctgacactatatactggccgtgggggtgatctgcagaagattggagaattctgtatggtttattctgaggttcctaacttcagtgagccaaacccagagtacagcacccagcaggcacccaacaaggcggtgcagaacgacagcaacccttcagcttcccagcctaccactggaccctctgctgcctctccagcctctgagaaccagaatgggaatggactgagtgccccaccaggtcccggtggtggcccacatccccctcatactccctcccacccacccagcacccgaatcactcgaagccagcccaaccacacacctgcaggcccgcctggcccttccagcaaccctgttagtaacggcaaagaaacccggaggagcagcaagagatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CASP2 and RIPK1 domain containing adaptor with death domain - ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) - proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) - cysteine-rich secretory protein LCCL domain containing 2 |