Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
IGHV7-81-immunoglobulin heavy variable 7-81 (non-functional) Gene
PTXBC032733
New product
Data sheet of IGHV7-81-immunoglobulin heavy variable 7-81 (non-functional) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IGHV7-81-immunoglobulin heavy variable 7-81 (non-functional) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032733 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IGHV7-81 |
| Origin species: | Human |
| Product name: | IGHV7-81-immunoglobulin heavy variable 7-81 (non-functional) Gene |
| Size: | 2ug |
| Accessions: | BC032733 |
| Gene id: | 28378 |
| Gene description: | immunoglobulin heavy variable 7-81 (non-functional) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggactggacctggagcatcctcttcttggtggcagcagcaacaggtacctactcccaggtgcagctggtgcagtctggccatgaggtgaagcagcctggggcctcagtgaaggtctcctgcaaggcttctggttacagtttcaccacctatggtatgaattgggtgccacaggcccctggacaagggcttgagtggatgggatggttcaacacctacactgggaacccaacatatgcccagggcttcacaggacggtttgtcttctccatggacacctctgccagcacagcatacctgcagatcagcagcctaaaggctgaggacatggccatgtattactgtgcgagatacaccatgtggaaacccacatcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DDI1, DNA-damage inducible 1, homolog 2 (S. cerevisiae) - glutathione peroxidase 4 (phospholipid hydroperoxidase) - cytochrome P450, family 4, subfamily V, polypeptide 2 - SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) |