Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DDI2-DDI1, DNA-damage inducible 1, homolog 2 (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DDI2-DDI1, DNA-damage inducible 1, homolog 2 (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006011 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DDI2 |
| Origin species: | Human |
| Product name: | DDI2-DDI1, DNA-damage inducible 1, homolog 2 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC006011 |
| Gene id: | 84301 |
| Gene description: | DDI1, DNA-damage inducible 1, homolog 2 (S. cerevisiae) |
| Synonyms: | DNA-damage inducible protein 2 (DDI2); protein DDI1 homolog 2; DDI1, DNA-damage inducible 1, homolog 2; DNA damage inducible 1 homolog 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgctcaccgtgtactgtgtgcggagggacctctccgaggtgaccttttccctccaggtcgacgccgacttcgagctgcacaacttccgcgcgctgtgcgagctcgagtctggcatccccgcagccgagagccagatcgtctatgcggaaagacctctcacagacaaccacagatcattggcttcttatggcttgaaagatggggacgttgtgattttacgacagaaggagaatgcagaccctcgacctccagtgcagttcccaaacttaccccgaatagatttcagtagtatagctgtgcctggcacatcaagtccccggcagcgccagccaccaggaacacagcagtcccactcatctcctggagaaataacttcatctcctcagggcttggacaatccagccttgctccgagatatgttgctggccaacccgcatgagctgtccttgctgaaggaacgcaatccacccctggcagaagctctgctcagtggagaccttgagaaattttctagagtcctggtggagcagcagcaggaccgagcccggagagagcaagaaaggattcgtctgttttctgctgatccctttgaccttgaagctcaggcaaagatagaagaagatataaggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glutathione peroxidase 4 (phospholipid hydroperoxidase) - cytochrome P450, family 4, subfamily V, polypeptide 2 - SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) - ArfGAP with SH3 domain, ankyrin repeat and PH domain 3 |