PTXBC011836
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC011836 |
Product type: | DNA & cDNA |
Ncbi symbol: | GPX4 |
Origin species: | Human |
Product name: | GPX4-glutathione peroxidase 4 (phospholipid hydroperoxidase) Gene |
Size: | 2ug |
Accessions: | BC011836 |
Gene id: | 2879 |
Gene description: | glutathione peroxidase 4 (phospholipid hydroperoxidase) |
Synonyms: | GPx-4; GSHPx-4; MCSP; PHGPx; SMDS; snGPx; snPHGPx; phospholipid hydroperoxide glutathione peroxidase, mitochondrial; phospholipid hydroperoxide glutathione peroxidase; phospholipid hydroperoxidase; sperm nucleus glutathione peroxidase; glutathione peroxidase 4 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgagcctcggccgcctttgccgcctactgaagccggcgctgctctgtggggctctggccgcgcctggcctggccgggaccatgtgcgcgtcccgggacgactggcgctgtgcgcgctccatgcacgagttttccgccaaggacatcgacgggcacatggttaacctggacaagtaccggggcttcgtgtgcatcgtcaccaacgtggcctcccagtgaggcaagaccgaagtaaactacactcagctcgtcgacctgcacgcccgatacgctgagtgtggtttgcggatcctggccttcccgtgtaaccagttcgggaagcaggagccagggagtaacgaagagatcaaagagttcgccgcgggctacaacgtcaaattcgatatgttcagcaagatctgcgtgaacggggacgacgcccacccgctgtggaagtggatgaagatccaacccaagggcaagggcatcctgggaaatgccatcaagtggaacttcaccaagttcctcatcgacaagaacggctgcgtggtgaagcgctacggacccatggaggagcccctggtgatagagaaggacctgccccactatttctag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - cytochrome P450, family 4, subfamily V, polypeptide 2 - SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) - ArfGAP with SH3 domain, ankyrin repeat and PH domain 3 - ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 |