Login to display prices
Login to display prices
DPF2-D4, zinc and double PHD fingers family 2 Gene View larger

DPF2-D4, zinc and double PHD fingers family 2 Gene

PTXBC014889

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DPF2-D4, zinc and double PHD fingers family 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DPF2-D4, zinc and double PHD fingers family 2 Gene

Proteogenix catalog: PTXBC014889
Ncbi symbol: DPF2
Product name: DPF2-D4, zinc and double PHD fingers family 2 Gene
Size: 2ug
Accessions: BC014889
Gene id: 5977
Gene description: D4, zinc and double PHD fingers family 2
Synonyms: REQ; UBID4; ubi-d4; zinc finger protein ubi-d4; BAF45D; BRG1-associated factor 45D; D4, zinc and double PHD fingers family 2; apoptosis response zinc finger protein; protein requiem; requiem, apoptosis response zinc finger; double PHD fingers 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctgtggtggagaatgtagtgaagctccttggggagcagtactacaaagatgccatggagcagtgccacaattacaatgctcgcctctgtgctgagcgcagcgtgcgcctgcctttcttggactcacagaccggagtagcccagagcaattgttacatctggatggaaaagcgacaccggggtccaggattggcctccggacagctgtactcctaccctgcccggcgctggcggaaaaagcggcgagcccatccccctgaggatccacgactttccttcccatctattaagccagacacagaccagaccctgaagaaggaggggctgatctctcaggatggcagtagtttagaggctctgttgcgcactgaccccctggagaagcgaggtgccccggatccccgagttgatgatgacagcctgggcgagtttcctgtgaccaacagtcgagcgcgaaagcggatcctagaaccagatgacttcctggatgacctcgatgatgaagactatgaagaagatactcccaagcgtcggggaaaggggaaatccaagggtaagggtgtgggcagtgcccgtaagaagctggatgcttccatcctggaggaccgggataagccctatgcctgtgacatttgtggaaaacgttacaagaaccgaccaggcctcagttaccactatgcccactcccacttggctgaggaggagggcgaggacaaggaagactctcaaccacccactcctgtttcccagaggtctgaggagcagaaatccaaaaagggtcctgatggattggccttgcccaacaactactgtgacttctgcctgggggactcaaagattaacaagaagacgggacaacccgaggagctggtgtcctgttctgactgtggccgctcagggcatccatcttgcctccaatttacccccgtgatgatggcggcagtgaagacataccgctggcagtgcatcgagtgcaaatgttgcaatatctgcggcacctccgagaatgacgaccagttgctcttctgtgatgactgcgatcgtggctaccacatgtactgtctcaccccgtccatgtctgagccccctgaaggaagttggagctgccacctgtgtctggacctgttgaaagagaaagcttccatctaccagaaccagaactcctcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: