DPF2-D4, zinc and double PHD fingers family 2 Gene View larger

DPF2-D4, zinc and double PHD fingers family 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DPF2-D4, zinc and double PHD fingers family 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DPF2-D4, zinc and double PHD fingers family 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014889
Product type: DNA & cDNA
Ncbi symbol: DPF2
Origin species: Human
Product name: DPF2-D4, zinc and double PHD fingers family 2 Gene
Size: 2ug
Accessions: BC014889
Gene id: 5977
Gene description: D4, zinc and double PHD fingers family 2
Synonyms: REQ; UBID4; ubi-d4; zinc finger protein ubi-d4; BAF45D; BRG1-associated factor 45D; D4, zinc and double PHD fingers family 2; apoptosis response zinc finger protein; protein requiem; requiem, apoptosis response zinc finger; double PHD fingers 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctgtggtggagaatgtagtgaagctccttggggagcagtactacaaagatgccatggagcagtgccacaattacaatgctcgcctctgtgctgagcgcagcgtgcgcctgcctttcttggactcacagaccggagtagcccagagcaattgttacatctggatggaaaagcgacaccggggtccaggattggcctccggacagctgtactcctaccctgcccggcgctggcggaaaaagcggcgagcccatccccctgaggatccacgactttccttcccatctattaagccagacacagaccagaccctgaagaaggaggggctgatctctcaggatggcagtagtttagaggctctgttgcgcactgaccccctggagaagcgaggtgccccggatccccgagttgatgatgacagcctgggcgagtttcctgtgaccaacagtcgagcgcgaaagcggatcctagaaccagatgacttcctggatgacctcgatgatgaagactatgaagaagatactcccaagcgtcggggaaaggggaaatccaagggtaagggtgtgggcagtgcccgtaagaagctggatgcttccatcctggaggaccgggataagccctatgcctgtgacatttgtggaaaacgttacaagaaccgaccaggcctcagttaccactatgcccactcccacttggctgaggaggagggcgaggacaaggaagactctcaaccacccactcctgtttcccagaggtctgaggagcagaaatccaaaaagggtcctgatggattggccttgcccaacaactactgtgacttctgcctgggggactcaaagattaacaagaagacgggacaacccgaggagctggtgtcctgttctgactgtggccgctcagggcatccatcttgcctccaatttacccccgtgatgatggcggcagtgaagacataccgctggcagtgcatcgagtgcaaatgttgcaatatctgcggcacctccgagaatgacgaccagttgctcttctgtgatgactgcgatcgtggctaccacatgtactgtctcaccccgtccatgtctgagccccctgaaggaagttggagctgccacctgtgtctggacctgttgaaagagaaagcttccatctaccagaaccagaactcctcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lysosomal-associated membrane protein 1
- isocitrate dehydrogenase 3 (NAD+) gamma
- transmembrane and coiled-coil domains 3
- colony stimulating factor 1 (macrophage)

Buy DPF2-D4, zinc and double PHD fingers family 2 Gene now

Add to cart