IDH3G-isocitrate dehydrogenase 3 (NAD+) gamma Gene View larger

IDH3G-isocitrate dehydrogenase 3 (NAD+) gamma Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IDH3G-isocitrate dehydrogenase 3 (NAD+) gamma Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IDH3G-isocitrate dehydrogenase 3 (NAD+) gamma Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000933
Product type: DNA & cDNA
Ncbi symbol: IDH3G
Origin species: Human
Product name: IDH3G-isocitrate dehydrogenase 3 (NAD+) gamma Gene
Size: 2ug
Accessions: BC000933
Gene id: 3421
Gene description: isocitrate dehydrogenase 3 (NAD+) gamma
Synonyms: H-IDHG; isocitrate dehydrogenase [NAD] subunit gamma, mitochondrial; IDH-gamma; NAD (H)-specific isocitrate dehydrogenase gamma subunit; NAD(+)-specific ICDH subunit gamma; NAD+-specific ICDH; isocitrate dehydrogenase 3 (NAD+) gamma; isocitrate dehydrogenase 3 gamma; isocitrate dehydrogenase, NAD(+)-specific, mitochondrial, gamma subunit; isocitric dehydrogenase subunit gamma; isocitrate dehydrogenase 3 (NAD(+)) gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctgaaggtagcgaccgtcgccggcagcgccgcgaaggcggtgctcgggccagcccttctctgccgtccctgggaggttctaggcgcccacgaggtcccctcgaggaacatcttttcagaacaaacaattcctccgtccgctaagtatggcgggcggcacacggtgaccatgatcccaggggatggcatcgggccagagctcatgctgcatgtcaagtccgtcttcaggcacgcatgtgtaccagtggactttgaagaggtgcacgtgagttccaatgctgatgaagaggacattcgcaatgccatcatggccatccgccggaaccgcgtggccctgaagggcaacatcgaaaccaaccataacctgccaccgtcgcacaaatctcgaaacaacatccttcgcaccagcctggacctctatgccaacgtcatccactgtaagagccttccaggcgtggtgacccggcacaaggacatagacatcctcattgtccgggagaacacagagggcgagtacagcagcctggagcatgagagtgtggcgggagtggtggagagcctgaagatcatcaccaaggccaagtccctgcgcattgccgagtatgccttcaagctggcgcaggagagcgggcgcaagaaagtgacggccgtgcacaaggccaacatcatgaaactgggcgatgggcttttcctccagtgctgcagggaggtggcagcccgctaccctcagatcaccttcgagaacatgattgtggataacaccaccatgcagctggtgtcccggccccagcagtttgatgtcatggtgatgcccaatctctatggcaacatcgtcaacaatgtctgcgcgggactggtcgggggcccaggccttgtggctggggccaactatggccatgtgtacgcggtgtttgaaacagctacgaggaacaccggcaagagtatcgccaataagaacatcgccaaccccacggccaccctgctggccagctgcatgatgctggaccacctcaagctgcactcctatgccacctccatccgtaaggctgtcctggcatccatggacaatgagaatatgcacactccggacatcgggggccagggcacaacatctgaagccatccaggacgtcatccgccacatccgcgtcatcaacggccgggccgtggaggcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane and coiled-coil domains 3
- colony stimulating factor 1 (macrophage)
- poly(A) binding protein, cytoplasmic 3
- glutamate decarboxylase 1 (brain, 67kDa)

Buy IDH3G-isocitrate dehydrogenase 3 (NAD+) gamma Gene now

Add to cart